Strain Name:
C57BL/6J-MtgxR7635Btlr/Mmmh
Stock Number:
045694-MU
Citation ID:
RRID:MMRRC_045694-MU
Other Names:
R7635 (G1)
Major Collection:

Strain Information

Zfp143
Name: zinc finger protein 143
Synonyms: KRAB14, Zfp80-rs1, Zfp79, pHZ-1, Staf, D7Ertd805e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20841
Homologene: 56444
Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Gon4l
Name: gon-4 like
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76022
Homologene: 13002
Prune1
Name: prune exopolyphosphatase
Synonyms: 9230112O05Rik, Prune-M1, Prune
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229589
Homologene: 41429
Dnajc11
Name: DnaJ heat shock protein family (Hsp40) member C11
Synonyms: E030019A03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230935
Homologene: 14558
Fkbp5
Name: FK506 binding protein 5
Synonyms: Dit1, D17Ertd592e, FKBP51
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14229
HGNC: HGNC:3721
Homologene: 3038
Cdyl
Name: chromodomain protein, Y chromosome-like
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12593
VEGA: 13
HGNC: HGNC:1811
Homologene: 3548
Ap2b1
Name: adaptor-related protein complex 2, beta 1 subunit
Synonyms: 1300012O03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71770
HGNC: HGNC:563
Homologene: 137384
Specc1l
Name: sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms: 4932439K10Rik, 9530057A13Rik, 4930470P14Rik, Specc1l, Cytsa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74392
VEGA: 10
Homologene: 15610
Ttc27
Name: tetratricopeptide repeat domain 27
Synonyms: 2610511O17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74196
VEGA: 17
Homologene: 41191
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Zcchc6, Tent3b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 4932411G06Rik, 1700021E15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Cep350
Name: centrosomal protein 350
Synonyms: 4933409L06Rik, 6430546F08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74081
Homologene: 8879
Rbbp6
Name: retinoblastoma binding protein 6, ubiquitin ligase
Synonyms: 4933422O15Rik, C030034J04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19647
HGNC: HGNC:9889
Homologene: 136812
Mmp20
Name: matrix metallopeptidase 20 (enamelysin)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 30800
VEGA: 9
HGNC: HGNC:7167
Homologene: 21001
Map3k20
Name: mitogen-activated protein kinase kinase kinase 20
Synonyms: MLTKbeta, MLTKalpha, B230120H23Rik, Zak
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65964
Homologene: 32331
Cinp
Name: cyclin dependent kinase 2 interacting protein
Synonyms: 1810047K05Rik, 2810452K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67236
VEGA: 12
Homologene: 12103
Mmp16
Name: matrix metallopeptidase 16
Synonyms: Membrane type 3-MMP, MT3-MMP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17389
HGNC: HGNC:7162
Homologene: 55939
Plxna4
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243743
HGNC: HGNC:9102
Homologene: 77587
Lamc1
Name: laminin, gamma 1
Synonyms: Lamb2, laminin B2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226519
HGNC: HGNC:6492
Homologene: 1724
Tcea1
Name: transcription elongation factor A (SII) 1
Synonyms: S-II
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21399
Homologene: 55984
Tmem131
Name: transmembrane protein 131
Synonyms: D1Bwg0491e, YR-23, CC28, Neg, 2610524E03Rik, Rw1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56030
Homologene: 32428
Micu3
Name: mitochondrial calcium uptake family, member 3
Synonyms: 2900075B16Rik, Efha2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78506
Homologene: 15058
Clec14a
Name: C-type lectin domain family 14, member a
Synonyms: 1200003C23Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66864
VEGA: 12
Homologene: 12047
Mpp3
Name: membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Synonyms: Dlgh3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13384
HGNC: HGNC:7221
Homologene: 31065
Lclat1
Name: lysocardiolipin acyltransferase 1
Synonyms: ALCAT1, Lycat, AGPAT8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225010
Homologene: 33167
Rab4b
Name: RAB4B, member RAS oncogene family
Synonyms: 1500031G17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19342
HGNC: HGNC:9782
Homologene: 100632
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, Dnahc8, P1-Loop
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Sptbn2
Name: spectrin beta, non-erythrocytic 2
Synonyms: Spnb3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20743
VEGA: 19
Homologene: 48482
Wdr36
Name: WD repeat domain 36
Synonyms: 5730444A13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225348
VEGA: 18
Homologene: 6536
Dnajc13
Name: DnaJ heat shock protein family (Hsp40) member C13
Synonyms: Rme8, D030002L11Rik, LOC382100
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235567
Homologene: 13574
Atp8b1
Name: ATPase, class I, type 8B, member 1
Synonyms: FIC1, Ic
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 54670
VEGA: 18
HGNC: HGNC:3706
Homologene: 21151
Peg10
Name: paternally expressed 10
Synonyms: MyEF-3, MEF3L, Mart2, Edr, Mar2, MyEF-3 like, HB-1, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Scn4a
Name: sodium channel, voltage-gated, type IV, alpha
Synonyms: Nav1.4, mH2, SkM1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 110880
Homologene: 283
Smco2
Name: single-pass membrane protein with coiled-coil domains 2
Synonyms: 1700023A16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69371
Homologene: 106211
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Usp2
Name: ubiquitin specific peptidase 2
Synonyms: ubp41, B930035K21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53376
Homologene: 3098
Ttn
Name: titin
Synonyms: connectin, 1100001C23Rik, D330041I19Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, 2310057K23Rik, shru, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 674895
Homologene: 130947
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: 2410089E03Rik, Jbts17, Hug, b2b012Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Slc7a1
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 1
Synonyms: 4831426K01Rik, Rev-1, Atrc1, Rec-1, Cat1, mCAT-1, Atrc-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11987
Homologene: 20658
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Astn1
Name: astrotactin 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11899
HGNC: HGNC:773
Homologene: 7233
Vwf
Name: Von Willebrand factor
Synonyms: 6820430P06Rik, B130011O06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22371
Homologene: 466
Got1l1
Name: glutamic-oxaloacetic transaminase 1-like 1
Synonyms: 1700083M11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76615
Homologene: 65045
Adamts7
Name: ADAM metallopeptidase with thrombospondin type 1 motif 7
Synonyms: ADAM-TS7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108153
HGNC: HGNC:223
Homologene: 22803
Gm10036
Name: predicted gene 10036
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100040551
VEGA: 18
Or11l3
Name: olfactory receptor family 11 subfamily L member 3
Synonyms: MOR107-1, GA_x6K02T2NKPP-794386-795357, Olfr323
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258373
Homologene: 64865
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
AI661453
Name: expressed sequence AI661453
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224833
Homologene: 138294
Fads2b
Name: fatty acid desaturase 2B
Synonyms: 4833423E24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228151
Homologene: 105643
Myo5b
Name: myosin VB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17919
HGNC: HGNC:7603
Homologene: 49481
Pcnx1
Name: pecanex 1
Synonyms: 3526401J03Rik, 2900024E21Rik, Pcnx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
Pld5
Name: phospholipase D family member 5
Synonyms: B230365F16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319455
Homologene: 16081
Pex6
Name: peroxisomal biogenesis factor 6
Synonyms: D130055I09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224824
HGNC: HGNC:8859
Homologene: 47914
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, Pla2g1br, M-type receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Zswim8
Name: zinc finger SWIM-type containing 8
Synonyms: 4832404P21Rik, 2310021P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268721
VEGA: 14
Homologene: 34313
Galnt13
Name: polypeptide N-acetylgalactosaminyltransferase 13
Synonyms: pp-GalNAc-T13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271786
Homologene: 62167
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Catip
Name: ciliogenesis associated TTC17 interacting protein
Synonyms: Gm216, LOC241112
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241112
Pramel26
Name: PRAME like 26
Synonyms: Gm13084
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381569
Homologene: 77858
Itga2b
Name: integrin alpha 2b
Synonyms: platelet glycoprotein IIb, GP IIb, GpIIb, alphaIIb, CD41
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16399
HGNC: HGNC:6138
Homologene: 37304
Vmn1r10
Name: vomeronasal 1 receptor 10
Synonyms: V1rc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113858
Homologene: 76459
Rnf215
Name: ring finger protein 215
Synonyms: 0610009J22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71673
Homologene: 12402
Car7
Name: carbonic anhydrase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12354
HGNC: HGNC:1381
Homologene: 55875
Alpk1
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71481
Homologene: 11849
Foxf2
Name: forkhead box F2
Synonyms: LUN, Fkh20, FREAC2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14238
HGNC: HGNC:3810
Homologene: 1115
Or6c2
Name: olfactory receptor family 6 subfamily C member 2
Synonyms: MOR114-1, GA_x6K02T2PULF-11205096-11206034, Olfr791
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258932
Homologene: 71950
Gata5
Name: GATA binding protein 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14464
Homologene: 32031
Ephb4
Name: Eph receptor B4
Synonyms: Htk, b2b2412Clo, Tyro11, MDK2, Myk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13846
HGNC: HGNC:3395
Homologene: 20939
Vmn1r234
Name: vomeronasal 1 receptor 234
Synonyms: V1rf1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171232
Spns3
Name: SPNS lysolipid transporter 3, sphingosine-1-phosphate (putative)
Synonyms: 9830002I17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77577
Homologene: 45648
Prl2c2
Name: prolactin family 2, subfamily c, member 2
Synonyms: PLF-1, MRP-1, Plf1, Plf
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18811
VEGA: 13
Homologene: 40763
Rem1
Name: rad and gem related GTP binding protein 1
Synonyms: E030011C07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19700
Homologene: 7514
1700102P08Rik
Name: RIKEN cDNA 1700102P08 gene
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 112418
Homologene: 14230
Gal3st3
Name: galactose-3-O-sulfotransferase 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 545276
VEGA: 19
Homologene: 57198
Aqp5
Name: aquaporin 5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11830
VEGA: 15
HGNC: HGNC:638
Homologene: 20398
Pou2af1
Name: POU domain, class 2, associating factor 1
Synonyms: OBF.1, BOB.1, OCAB, Bob1, OCA-B, OBF-1, Bob-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18985
VEGA: 9
HGNC: HGNC:9211
Homologene: 4543
Igkv7-33
Name: immunoglobulin kappa chain variable 7-33
Synonyms: U29423
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243461
HGNC: HGNC:5834
Tas2r107
Name: taste receptor, type 2, member 107
Synonyms: T2R4, Tas2r7, STC 5-1, T2R07, mt2r43, mGR06
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387342
Homologene: 137369
Serpine3
Name: serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3
Synonyms: E130113E03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319433
VEGA: 14
Homologene: 53117
Reep5
Name: receptor accessory protein 5
Synonyms: TB2/DP1, DP1/TB2, Dp1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13476
VEGA: 18
Homologene: 68479
Tpbpb
Name: trophoblast specific protein beta
Synonyms: 1600012N09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 116913
VEGA: 13
Homologene: 49203
Or6z1
Name: olfactory receptor family 6 subfamily Z member 1
Synonyms: MOR103-9, GA_x6K02T2QGBW-3232059-3231121, Olfr1348
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258915
Homologene: 17435
Myl10
Name: myosin, light chain 10, regulatory
Synonyms: Mylc2pl, 1700027I08Rik, PLRLC, PLRLC-A, PLRLC-B, PLRLC-C
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59310
Homologene: 69341
Taf1a
Name: TATA-box binding protein associated factor, RNA polymerase I, A
Synonyms: mTAFI48
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21339
Homologene: 4155
Zfp383
Name: zinc finger protein 383
Synonyms: 1110003H10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73729
Homologene: 128413
Spata25
Name: spermatogenesis associated 25
Synonyms: 1700020C07Rik, TSG23
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75642
Homologene: 15415
Hmx1
Name: H6 homeobox 1
Synonyms: Nkx5-3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15371
HGNC: HGNC:5017
Homologene: 49241
Frmpd2
Name: FERM and PDZ domain containing 2
Synonyms: LOC268729, Frmpd2, LOC380890, Gm626, ENSMUSG00000071536
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268729
Homologene: 51854
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 4,889,551 bp
  • A to T, chromosome 1 at 36,872,548 bp
  • T to A, chromosome 1 at 74,368,962 bp
  • C to T, chromosome 1 at 153,249,060 bp
  • A to T, chromosome 1 at 155,879,021 bp
  • G to A, chromosome 1 at 158,667,535 bp
  • A to T, chromosome 1 at 175,993,850 bp
  • T to C, chromosome 1 at 183,408,434 bp
  • A to G, chromosome 2 at 41,123,597 bp
  • A to G, chromosome 2 at 54,857,817 bp
  • T to A, chromosome 2 at 60,534,762 bp
  • A to T, chromosome 2 at 71,843,233 bp
  • T to C, chromosome 2 at 72,402,004 bp
  • T to C, chromosome 2 at 76,749,677 bp
  • T to A, chromosome 2 at 85,500,237 bp
  • G to C, chromosome 2 at 152,634,665 bp
  • G to A, chromosome 2 at 164,827,969 bp
  • G to T, chromosome 2 at 180,333,997 bp
  • A to G, chromosome 3 at 88,895,106 bp
  • A to G, chromosome 3 at 95,255,285 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • A to G, chromosome 3 at 127,695,661 bp
  • T to C, chromosome 4 at 18,054,382 bp
  • T to C, chromosome 4 at 143,810,417 bp
  • T to C, chromosome 4 at 151,968,611 bp
  • C to A, chromosome 5 at 35,392,239 bp
  • T to C, chromosome 5 at 108,229,049 bp
  • A to T, chromosome 5 at 136,700,864 bp
  • A to G, chromosome 5 at 137,372,103 bp
  • A to G, chromosome 5 at 148,352,236 bp
  • T to C, chromosome 6 at 4,754,938 bp
  • A to G, chromosome 6 at 32,496,741 bp
  • A to G, chromosome 6 at 57,114,041 bp
  • A to T, chromosome 6 at 70,059,154 bp
  • G to T, chromosome 6 at 125,682,734 bp
  • G to T, chromosome 6 at 131,659,600 bp
  • A to T, chromosome 6 at 146,860,009 bp
  • G to A, chromosome 7 at 6,501,582 bp
  • A to T, chromosome 7 at 27,176,217 bp
  • G to A, chromosome 7 at 29,915,271 bp
  • T to C, chromosome 7 at 110,088,818 bp
  • T to G, chromosome 7 at 122,976,008 bp
  • A to T, chromosome 7 at 141,805,676 bp
  • A to T, chromosome 7 at 141,805,753 bp
  • G to A, chromosome 8 at 27,197,934 bp
  • A to G, chromosome 8 at 40,366,234 bp
  • T to C, chromosome 8 at 104,548,437 bp
  • A to G, chromosome 8 at 120,572,895 bp
  • A to T, chromosome 9 at 7,639,334 bp
  • C to T, chromosome 9 at 42,330,987 bp
  • T to C, chromosome 9 at 44,067,222 bp
  • T to C, chromosome 9 at 51,232,983 bp
  • C to T, chromosome 9 at 90,195,245 bp
  • A to T, chromosome 9 at 104,162,367 bp
  • A to G, chromosome 9 at 108,110,990 bp
  • A to C, chromosome 9 at 108,397,406 bp
  • A to T, chromosome 10 at 39,092,188 bp
  • A to G, chromosome 10 at 75,276,804 bp
  • A to T, chromosome 10 at 129,526,682 bp
  • C to T, chromosome 11 at 4,139,989 bp
  • T to A, chromosome 11 at 58,625,164 bp
  • C to T, chromosome 11 at 72,539,034 bp
  • T to C, chromosome 11 at 83,389,728 bp
  • T to C, chromosome 11 at 102,025,383 bp
  • C to T, chromosome 11 at 102,461,756 bp
  • C to A, chromosome 11 at 106,324,632 bp
  • A to G, chromosome 12 at 58,268,528 bp
  • A to G, chromosome 12 at 81,919,125 bp
  • A to G, chromosome 12 at 110,884,013 bp
  • T to C, chromosome 13 at 12,997,343 bp
  • C to A, chromosome 13 at 31,626,104 bp
  • T to C, chromosome 13 at 35,871,651 bp
  • T to C, chromosome 13 at 59,800,090 bp
  • A to G, chromosome 13 at 60,902,111 bp
  • G to A, chromosome 14 at 14,850,932 bp
  • A to G, chromosome 14 at 20,716,300 bp
  • C to A, chromosome 14 at 33,500,963 bp
  • A to T, chromosome 14 at 62,673,015 bp
  • A to G, chromosome 15 at 8,226,920 bp
  • T to A, chromosome 15 at 99,594,178 bp
  • T to C, chromosome 17 at 21,229,217 bp
  • T to C, chromosome 17 at 28,428,361 bp
  • G to C, chromosome 17 at 30,785,107 bp
  • G to A, chromosome 17 at 46,724,017 bp
  • A to T, chromosome 17 at 47,467,751 bp
  • C to T, chromosome 17 at 73,161,936 bp
  • A to T, chromosome 17 at 74,718,715 bp
  • T to A, chromosome 18 at 15,833,289 bp
  • T to C, chromosome 18 at 32,850,525 bp
  • C to T, chromosome 18 at 34,349,800 bp
  • T to C, chromosome 18 at 64,573,305 bp
  • T to A, chromosome 18 at 74,580,396 bp
  • C to T, chromosome 19 at 4,744,207 bp
  • C to A, chromosome 19 at 5,307,406 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7635 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045694-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.