Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7635Btlr/Mmmh
Stock Number:
045694-MU
Citation ID:
RRID:MMRRC_045694-MU
Other Names:
R7635 (G1)
Major Collection:

Strain Information

Zfp143
Name: zinc finger protein 143
Synonyms: D7Ertd805e, pHZ-1, KRAB14, Zfp79, Zfp80-rs1, Staf
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20841
Homologene: 56444
Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Gon4l
Name: gon-4 like
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76022
Homologene: 13002
Prune1
Name: prune exopolyphosphatase
Synonyms: 9230112O05Rik, Prune-M1, Prune
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229589
Homologene: 41429
Dnajc11
Name: DnaJ heat shock protein family (Hsp40) member C11
Synonyms: E030019A03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230935
Homologene: 14558
Fkbp5
Name: FK506 binding protein 5
Synonyms: FKBP51, Dit1, D17Ertd592e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14229
HGNC: HGNC:3721
Homologene: 3038
Cdyl
Name: chromodomain protein, Y chromosome-like
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12593
VEGA: 13
HGNC: HGNC:1811
Homologene: 3548
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 4,889,551 bp
  • A to T, chromosome 1 at 36,872,548 bp
  • T to A, chromosome 1 at 74,368,962 bp
  • C to T, chromosome 1 at 153,249,060 bp
  • A to T, chromosome 1 at 155,879,021 bp
  • G to A, chromosome 1 at 158,667,535 bp
  • A to T, chromosome 1 at 175,993,850 bp
  • T to C, chromosome 1 at 183,408,434 bp
  • A to G, chromosome 2 at 41,123,597 bp
  • A to G, chromosome 2 at 54,857,817 bp
  • T to A, chromosome 2 at 60,534,762 bp
  • A to T, chromosome 2 at 71,843,233 bp
  • T to C, chromosome 2 at 72,402,004 bp
  • T to C, chromosome 2 at 76,749,677 bp
  • T to A, chromosome 2 at 85,500,237 bp
  • G to C, chromosome 2 at 152,634,665 bp
  • G to A, chromosome 2 at 164,827,969 bp
  • G to T, chromosome 2 at 180,333,997 bp
  • A to G, chromosome 3 at 88,895,106 bp
  • A to G, chromosome 3 at 95,255,285 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • A to G, chromosome 3 at 127,695,661 bp
  • T to C, chromosome 4 at 18,054,382 bp
  • T to C, chromosome 4 at 143,810,417 bp
  • T to C, chromosome 4 at 151,968,611 bp
  • C to A, chromosome 5 at 35,392,239 bp
  • T to C, chromosome 5 at 108,229,049 bp
  • A to T, chromosome 5 at 136,700,864 bp
  • A to G, chromosome 5 at 137,372,103 bp
  • A to G, chromosome 5 at 148,352,236 bp
  • T to C, chromosome 6 at 4,754,938 bp
  • A to G, chromosome 6 at 32,496,741 bp
  • A to G, chromosome 6 at 57,114,041 bp
  • A to T, chromosome 6 at 70,059,154 bp
  • G to T, chromosome 6 at 125,682,734 bp
  • G to T, chromosome 6 at 131,659,600 bp
  • A to T, chromosome 6 at 146,860,009 bp
  • G to A, chromosome 7 at 6,501,582 bp
  • A to T, chromosome 7 at 27,176,217 bp
  • G to A, chromosome 7 at 29,915,271 bp
  • T to C, chromosome 7 at 110,088,818 bp
  • T to G, chromosome 7 at 122,976,008 bp
  • A to T, chromosome 7 at 141,805,676 bp
  • A to T, chromosome 7 at 141,805,753 bp
  • G to A, chromosome 8 at 27,197,934 bp
  • A to G, chromosome 8 at 40,366,234 bp
  • T to C, chromosome 8 at 104,548,437 bp
  • A to G, chromosome 8 at 120,572,895 bp
  • A to T, chromosome 9 at 7,639,334 bp
  • C to T, chromosome 9 at 42,330,987 bp
  • T to C, chromosome 9 at 44,067,222 bp
  • T to C, chromosome 9 at 51,232,983 bp
  • C to T, chromosome 9 at 90,195,245 bp
  • A to T, chromosome 9 at 104,162,367 bp
  • A to G, chromosome 9 at 108,110,990 bp
  • A to C, chromosome 9 at 108,397,406 bp
  • A to T, chromosome 10 at 39,092,188 bp
  • A to G, chromosome 10 at 75,276,804 bp
  • A to T, chromosome 10 at 129,526,682 bp
  • C to T, chromosome 11 at 4,139,989 bp
  • T to A, chromosome 11 at 58,625,164 bp
  • C to T, chromosome 11 at 72,539,034 bp
  • T to C, chromosome 11 at 83,389,728 bp
  • T to C, chromosome 11 at 102,025,383 bp
  • C to T, chromosome 11 at 102,461,756 bp
  • C to A, chromosome 11 at 106,324,632 bp
  • A to G, chromosome 12 at 58,268,528 bp
  • A to G, chromosome 12 at 81,919,125 bp
  • A to G, chromosome 12 at 110,884,013 bp
  • T to C, chromosome 13 at 12,997,343 bp
  • C to A, chromosome 13 at 31,626,104 bp
  • T to C, chromosome 13 at 35,871,651 bp
  • T to C, chromosome 13 at 59,800,090 bp
  • A to G, chromosome 13 at 60,902,111 bp
  • G to A, chromosome 14 at 14,850,932 bp
  • A to G, chromosome 14 at 20,716,300 bp
  • C to A, chromosome 14 at 33,500,963 bp
  • A to T, chromosome 14 at 62,673,015 bp
  • A to G, chromosome 15 at 8,226,920 bp
  • T to A, chromosome 15 at 99,594,178 bp
  • T to C, chromosome 17 at 21,229,217 bp
  • T to C, chromosome 17 at 28,428,361 bp
  • G to C, chromosome 17 at 30,785,107 bp
  • G to A, chromosome 17 at 46,724,017 bp
  • A to T, chromosome 17 at 47,467,751 bp
  • C to T, chromosome 17 at 73,161,936 bp
  • A to T, chromosome 17 at 74,718,715 bp
  • T to A, chromosome 18 at 15,833,289 bp
  • T to C, chromosome 18 at 32,850,525 bp
  • C to T, chromosome 18 at 34,349,800 bp
  • T to C, chromosome 18 at 64,573,305 bp
  • T to A, chromosome 18 at 74,580,396 bp
  • C to T, chromosome 19 at 4,744,207 bp
  • C to A, chromosome 19 at 5,307,406 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7635 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045694-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.