Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7625Btlr/Mmmh
Stock Number:
045719-MU
Citation ID:
RRID:MMRRC_045719-MU
Other Names:
R7625 (G1)
Major Collection:

Strain Information

Camk2a
Name: calcium/calmodulin-dependent protein kinase II alpha
Synonyms: alpha-CaMKII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12322
HGNC: HGNC:1460
Homologene: 56577
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Dgat1
Name: diacylglycerol O-acyltransferase 1
Synonyms: D15Ertd23e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13350
HGNC: HGNC:2843
Homologene: 7688
Anxa4
Name: annexin A4
Synonyms: Anx4, Xanx-4, annexin IV, AIV
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11746
HGNC: HGNC:542
Homologene: 68164
Col6a1
Name: collagen, type VI, alpha 1
Synonyms: Col6a-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12833
HGNC: HGNC:2211
Homologene: 1391
Pelp1
Name: proline, glutamic acid and leucine rich protein 1
Synonyms: 4930563C04Rik, MNAR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75273
Homologene: 8664
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 65,267,877 bp
  • A to T, chromosome 1 at 86,426,737 bp
  • G to C, chromosome 1 at 135,467,745 bp
  • G to A, chromosome 1 at 174,137,167 bp
  • G to A, chromosome 2 at 45,002,572 bp
  • T to C, chromosome 2 at 150,254,600 bp
  • T to C, chromosome 3 at 40,697,599 bp
  • C to A, chromosome 3 at 89,609,670 bp
  • T to G, chromosome 3 at 127,052,800 bp
  • G to A, chromosome 4 at 126,443,229 bp
  • T to A, chromosome 4 at 137,564,938 bp
  • A to T, chromosome 4 at 143,572,251 bp
  • T to C, chromosome 5 at 101,855,386 bp
  • T to A, chromosome 5 at 110,829,146 bp
  • G to A, chromosome 5 at 111,285,219 bp
  • C to A, chromosome 5 at 112,308,021 bp
  • T to C, chromosome 5 at 149,050,340 bp
  • A to G, chromosome 5 at 149,618,436 bp
  • G to A, chromosome 6 at 30,116,231 bp
  • T to C, chromosome 6 at 55,276,613 bp
  • T to C, chromosome 6 at 86,737,819 bp
  • T to A, chromosome 6 at 103,729,125 bp
  • G to T, chromosome 6 at 124,437,418 bp
  • T to C, chromosome 7 at 4,370,174 bp
  • A to G, chromosome 7 at 30,078,505 bp
  • T to A, chromosome 7 at 35,752,681 bp
  • A to G, chromosome 7 at 103,639,958 bp
  • G to A, chromosome 7 at 139,938,017 bp
  • T to A, chromosome 8 at 61,372,722 bp
  • A to T, chromosome 8 at 88,665,278 bp
  • A to G, chromosome 8 at 105,704,633 bp
  • A to T, chromosome 8 at 110,541,844 bp
  • T to A, chromosome 8 at 111,046,955 bp
  • A to T, chromosome 9 at 7,566,217 bp
  • A to T, chromosome 9 at 44,250,297 bp
  • A to T, chromosome 9 at 46,243,112 bp
  • A to T, chromosome 10 at 5,841,488 bp
  • A to T, chromosome 10 at 40,848,052 bp
  • A to G, chromosome 10 at 62,134,700 bp
  • A to G, chromosome 10 at 76,713,926 bp
  • A to G, chromosome 10 at 79,542,709 bp
  • A to C, chromosome 10 at 80,520,146 bp
  • CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG to CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG, chromosome 10 at 81,321,318 bp
  • A to C, chromosome 11 at 66,925,943 bp
  • G to T, chromosome 11 at 70,395,434 bp
  • G to A, chromosome 11 at 96,819,445 bp
  • T to C, chromosome 12 at 87,608,312 bp
  • T to A, chromosome 12 at 118,196,642 bp
  • T to A, chromosome 14 at 9,870,177 bp
  • G to A, chromosome 14 at 52,237,077 bp
  • G to A, chromosome 14 at 75,272,549 bp
  • T to A, chromosome 14 at 119,026,493 bp
  • T to C, chromosome 15 at 7,169,242 bp
  • T to C, chromosome 15 at 76,503,195 bp
  • A to G, chromosome 15 at 98,066,798 bp
  • A to G, chromosome 15 at 100,254,277 bp
  • T to C, chromosome 17 at 18,105,431 bp
  • T to A, chromosome 17 at 22,201,755 bp
  • G to A, chromosome 18 at 37,726,901 bp
  • G to A, chromosome 18 at 60,952,340 bp
  • G to T, chromosome 18 at 74,804,142 bp
  • T to A, chromosome 19 at 11,390,364 bp
  • T to A, chromosome 19 at 39,462,924 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7625 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045719-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.