Strain Name:
C57BL/6J-MtgxR7632Btlr/Mmmh
Stock Number:
045720-MU
Citation ID:
RRID:MMRRC_045720-MU
Other Names:
R7632 (G1)
Major Collection:

Strain Information

Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Cdh11
Name: cadherin 11
Synonyms: OB-cadherin, osteoblast-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: D5Bwg1524e, Rutbc2, 2410098H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Cep83
Name: centrosomal protein 83
Synonyms: 4921537D05Rik, 5730513H21Rik, 2600001G24Rik, Ccdc41
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77048
VEGA: 10
Homologene: 9396
Plxnd1
Name: plexin D1
Synonyms: b2b1863Clo, 6230425C21Rik, b2b553Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Ywhah
Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Synonyms: 14-3-3 eta
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22629
Homologene: 37767
Tfg
Name: Trk-fused gene
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21787
Homologene: 4426
Rgs12
Name: regulator of G-protein signaling 12
Synonyms: 1200016K18Rik, 4632412M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71729
HGNC: HGNC:9994
Homologene: 2195
Pogz
Name: pogo transposable element with ZNF domain
Synonyms: 9530006B08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229584
Homologene: 9022
Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: SREBP2gc, lop13, SREBP2, SREBP-2, nuc, bHLHd2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Ap2a2
Name: adaptor-related protein complex 2, alpha 2 subunit
Synonyms: Adtab, alpha-adaptin C, 2410074K14Rik, L25, alpha-C adaptin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11772
HGNC: HGNC:562
Homologene: 5335
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: 4632404O06Rik, 2810004D21Rik, Ndrp, Wdr11
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Smc4
Name: structural maintenance of chromosomes 4
Synonyms: Smc4l1, 2500002A22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70099
Homologene: 4015
Rsf1
Name: remodeling and spacing factor 1
Synonyms: 4832420A03Rik, p325, C030033M12Rik, Hbxap, XAP8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: Loa, dynein heavy chain, retrograde transport, Dnchc1, Swl, MAP1C, 9930018I23Rik, Dnec1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Dhx40
Name: DEAH-box helicase 40
Synonyms: ARG147, 2410016C14Rik, DDX40
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67487
Homologene: 57000
Sltm
Name: SAFB-like, transcription modulator
Synonyms: 5730555F13Rik, 5730455C01Rik, 9130215G10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66660
VEGA: 9
Homologene: 11696
Tmem245
Name: transmembrane protein 245
Synonyms: D730040F13Rik, A630051L19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242474
HGNC: HGNC:1363
Homologene: 41841
Pabpc1
Name: poly(A) binding protein, cytoplasmic 1
Synonyms: Pabp1, Pabpl1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18458
Homologene: 37638
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: LOC380777, skNAC
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Cdh9
Name: cadherin 9
Synonyms: T1-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12565
HGNC: HGNC:1768
Homologene: 9450
Isl2
Name: insulin related protein 2 (islet 2)
Synonyms: islet-2, 3110001N10Rik, islet 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104360
Homologene: 10730
Ccnb1
Name: cyclin B1
Synonyms: Cycb-4, Ccnb1-rs13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268697
HGNC: HGNC:1579
Homologene: 68982
Plod1
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Synonyms: 2410042F05Rik, LH1, lysyl hydroxylase 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18822
HGNC: HGNC:9081
Homologene: 256
Trim25
Name: tripartite motif-containing 25
Synonyms: estrogen-responsive finger protein, Zfp147
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217069
Homologene: 48325
Bach1
Name: BTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms: 6230421P05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12013
HGNC: HGNC:935
Homologene: 916
Pprc1
Name: peroxisome proliferative activated receptor, gamma, coactivator-related 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226169
Homologene: 9006
Flcn
Name: folliculin
Synonyms: B430214A04Rik, BHD
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216805
Homologene: 14583
Usp37
Name: ubiquitin specific peptidase 37
Synonyms: 4932415L06Rik, C330008N13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319651
Homologene: 10858
Caprin2
Name: caprin family member 2
Synonyms: RNG140, Eeg1, C1qdc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232560
Homologene: 11393
Kat2a
Name: K(lysine) acetyltransferase 2A
Synonyms: Gcn5, Gcn5l2, 1110051E14Rik, PCAF-B/GCN5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14534
HGNC: HGNC:4201
Homologene: 41343
Cspg4b
Name: chondroitin sulfate proteoglycan 4B
Synonyms: BC067074
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408066
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Scaf1
Name: SR-related CTD-associated factor 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233208
Plekhg4
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms: 4931414L13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102075
Homologene: 18516
Gm5800
Name: predicted gene 5800
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545047
Homologene: 128452
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: GluN2B, GluRepsilon2, Nmdar2b, NMDAR2B, NR2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Ghrhr
Name: growth hormone releasing hormone receptor
Synonyms: Ghrfr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14602
HGNC: HGNC:4266
Homologene: 640
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Pcdhb8
Name: protocadherin beta 8
Synonyms: Pcdhb5C, PcdhbH
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93879
HGNC: HGNC:8690
Homologene: 89038
Atrnl1
Name: attractin like 1
Synonyms: Alp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226255
VEGA: 19
Homologene: 45809
Flnc
Name: filamin C, gamma
Synonyms: 1110055E19Rik, actin binding protein 280, Fln2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70381
Homologene: 9120
Rad51ap2
Name: RAD51 associated protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209550
VEGA: 12
Homologene: 85245
Lypd3
Name: Ly6/Plaur domain containing 3
Synonyms: C4.4A, 2310061G07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72434
Homologene: 8672
Snx33
Name: sorting nexin 33
Synonyms: E130307J07Rik, Sh3px3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235406
VEGA: 9
Homologene: 45165
D3Ertd751e
Name: DNA segment, Chr 3, ERATO Doi 751, expressed
Synonyms: 2810009O15Rik, 4930415G15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73852
Homologene: 12520
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 21674
Tmem237
Name: transmembrane protein 237
Synonyms: Als2cr4, LOC381259
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381259
Homologene: 17570
Armh1
Name: armadillo-like helical domain containing 1
Synonyms: LOC381544, LOC381543, Ncrna00082, Gm1661
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381544
Homologene: 28727
Vmn1r94
Name: vomeronasal 1 receptor 94
Synonyms: Gm6160
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620537
Homologene: 104166
Dqx1
Name: DEAQ RNA-dependent ATPase
Synonyms: 2310066E11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93838
Homologene: 14143
Hyou1
Name: hypoxia up-regulated 1
Synonyms: Grp170, 140 kDa, Orp150, CBP-140, Cab140
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12282
Homologene: 4658
Or4k44
Name: olfactory receptor family 4 subfamily K member 44
Synonyms: GA_x6K02T2Q125-72589785-72588847, MOR248-7, Olfr1294
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258887
Homologene: 74216
Slc18b1
Name: solute carrier family 18, subfamily B, member 1
Synonyms: 1110021L09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76306
Homologene: 33473
Or5b119
Name: olfactory receptor family 5 subfamily B member 119
Synonyms: MOR202-36, Olfr1475, GA_x6K02T2RE5P-3812807-3811863
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258298
Homologene: 77370
Scrn2
Name: secernin 2
Synonyms: SES2, D11Moh48
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217140
Homologene: 26698
Ppp1r3e
Name: protein phosphatase 1, regulatory subunit 3E
Synonyms: LOC382898, A630071A11Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105651
Homologene: 34797
Rrp8
Name: ribosomal RNA processing 8
Synonyms: 1500003O22Rik, 2900001K19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101867
Homologene: 5621
Map4k2
Name: mitogen-activated protein kinase kinase kinase kinase 2
Synonyms: BL44, Rab8ip
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 26412
HGNC: HGNC:6864
Homologene: 3370
Fut11
Name: fucosyltransferase 11
Synonyms: 3110009G03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73068
VEGA: 14
Homologene: 18313
B3gnt8
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
Synonyms: B3galt7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232984
Homologene: 18886
Pde2a
Name: phosphodiesterase 2A, cGMP-stimulated
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207728
HGNC: HGNC:8777
Homologene: 1952
Fv1
Name: Friend virus susceptibility 1
Synonyms: Rv1, Fv-1, Rv-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14349
Igkv4-68
Name: immunoglobulin kappa variable 4-68
Synonyms: LOC232058, LOC384515
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 384515
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Igkv1-117
Name: immunoglobulin kappa variable 1-117
Synonyms: Gm16797
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16098
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 59,116,901 bp
  • T to C, chromosome 1 at 74,468,374 bp
  • T to C, chromosome 2 at 111,538,176 bp
  • A to G, chromosome 3 at 41,753,728 bp
  • CTA to CTATA, chromosome 3 at 69,018,067 bp
  • C to T, chromosome 3 at 83,348,050 bp
  • G to A, chromosome 3 at 94,856,206 bp
  • T to C, chromosome 4 at 56,916,787 bp
  • C to A, chromosome 4 at 117,213,741 bp
  • T to A, chromosome 4 at 147,869,935 bp
  • T to C, chromosome 4 at 147,927,024 bp
  • T to A, chromosome 5 at 33,026,666 bp
  • T to A, chromosome 5 at 34,965,590 bp
  • T to A, chromosome 5 at 113,276,082 bp
  • C to T, chromosome 5 at 144,218,726 bp
  • A to T, chromosome 6 at 29,446,985 bp
  • G to T, chromosome 6 at 55,384,742 bp
  • C to A, chromosome 6 at 68,121,808 bp
  • A to G, chromosome 6 at 69,305,064 bp
  • A to G, chromosome 6 at 83,059,699 bp
  • A to T, chromosome 6 at 115,976,639 bp
  • A to G, chromosome 6 at 135,732,555 bp
  • T to C, chromosome 6 at 148,883,456 bp
  • T to G, chromosome 7 at 20,167,771 bp
  • T to C, chromosome 7 at 24,638,440 bp
  • A to G, chromosome 7 at 25,628,435 bp
  • A to T, chromosome 7 at 45,007,079 bp
  • GGCG to GGCGACCGCCGCG, chromosome 7 at 97,579,906 bp
  • A to G, chromosome 7 at 101,484,594 bp
  • T to C, chromosome 7 at 105,736,520 bp
  • A to G, chromosome 7 at 141,631,323 bp
  • A to G, chromosome 8 at 82,046,339 bp
  • T to C, chromosome 8 at 102,673,883 bp
  • T to C, chromosome 8 at 105,380,150 bp
  • A to G, chromosome 9 at 44,381,136 bp
  • G to A, chromosome 9 at 55,541,156 bp
  • A to T, chromosome 9 at 56,926,418 bp
  • C to G, chromosome 9 at 70,586,673 bp
  • A to G, chromosome 9 at 82,903,190 bp
  • A to G, chromosome 10 at 23,826,182 bp
  • A to T, chromosome 10 at 94,750,640 bp
  • A to G, chromosome 10 at 107,711,922 bp
  • T to C, chromosome 10 at 128,040,506 bp
  • C to T, chromosome 11 at 59,795,799 bp
  • T to C, chromosome 11 at 86,799,437 bp
  • T to G, chromosome 11 at 89,015,776 bp
  • G to T, chromosome 11 at 97,033,142 bp
  • G to A, chromosome 11 at 100,708,596 bp
  • T to C, chromosome 12 at 11,457,115 bp
  • T to C, chromosome 12 at 110,660,893 bp
  • A to G, chromosome 13 at 100,781,701 bp
  • C to A, chromosome 13 at 113,320,886 bp
  • T to A, chromosome 14 at 20,695,028 bp
  • T to A, chromosome 14 at 51,716,448 bp
  • T to A, chromosome 14 at 54,877,069 bp
  • A to G, chromosome 15 at 16,851,029 bp
  • TGTACCTGTTGCATGGTA to TGTA, chromosome 15 at 36,597,968 bp
  • G to T, chromosome 15 at 82,185,296 bp
  • A to G, chromosome 16 at 56,712,634 bp
  • A to G, chromosome 16 at 87,720,143 bp
  • C to T, chromosome 17 at 32,158,506 bp
  • A to T, chromosome 18 at 37,355,595 bp
  • T to C, chromosome 19 at 6,344,054 bp
  • T to C, chromosome 19 at 13,479,431 bp
  • T to A, chromosome 19 at 46,072,282 bp
  • A to G, chromosome 19 at 57,630,306 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7632 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045720-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.