Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7632Btlr/Mmmh
Stock Number:
045720-MU
Citation ID:
RRID:MMRRC_045720-MU
Other Names:
R7632 (G1)
Major Collection:

Strain Information

Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Cdh11
Name: cadherin 11
Synonyms: osteoblast-cadherin, OB-cadherin, Cad11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12552
HGNC: HGNC:1750
Homologene: 1361
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Cep83
Name: centrosomal protein 83
Synonyms: 2600001G24Rik, 5730513H21Rik, 4921537D05Rik, Ccdc41
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77048
VEGA: 10
Homologene: 9396
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Ywhah
Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide
Synonyms: 14-3-3 eta
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22629
Homologene: 37767
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 59,116,901 bp
  • T to C, chromosome 1 at 74,468,374 bp
  • T to C, chromosome 2 at 111,538,176 bp
  • A to G, chromosome 3 at 41,753,728 bp
  • CTA to CTATA, chromosome 3 at 69,018,067 bp
  • C to T, chromosome 3 at 83,348,050 bp
  • G to A, chromosome 3 at 94,856,206 bp
  • T to C, chromosome 4 at 56,916,787 bp
  • C to A, chromosome 4 at 117,213,741 bp
  • T to A, chromosome 4 at 147,869,935 bp
  • T to C, chromosome 4 at 147,927,024 bp
  • T to A, chromosome 5 at 33,026,666 bp
  • T to A, chromosome 5 at 34,965,590 bp
  • T to A, chromosome 5 at 113,276,082 bp
  • C to T, chromosome 5 at 144,218,726 bp
  • A to T, chromosome 6 at 29,446,985 bp
  • G to T, chromosome 6 at 55,384,742 bp
  • C to A, chromosome 6 at 68,121,808 bp
  • A to G, chromosome 6 at 69,305,064 bp
  • A to G, chromosome 6 at 83,059,699 bp
  • A to T, chromosome 6 at 115,976,639 bp
  • A to G, chromosome 6 at 135,732,555 bp
  • T to C, chromosome 6 at 148,883,456 bp
  • T to G, chromosome 7 at 20,167,771 bp
  • T to C, chromosome 7 at 24,638,440 bp
  • A to G, chromosome 7 at 25,628,435 bp
  • A to T, chromosome 7 at 45,007,079 bp
  • GGCG to GGCGACCGCCGCG, chromosome 7 at 97,579,906 bp
  • A to G, chromosome 7 at 101,484,594 bp
  • T to C, chromosome 7 at 105,736,520 bp
  • A to G, chromosome 7 at 141,631,323 bp
  • A to G, chromosome 8 at 82,046,339 bp
  • T to C, chromosome 8 at 102,673,883 bp
  • T to C, chromosome 8 at 105,380,150 bp
  • A to G, chromosome 9 at 44,381,136 bp
  • G to A, chromosome 9 at 55,541,156 bp
  • A to T, chromosome 9 at 56,926,418 bp
  • C to G, chromosome 9 at 70,586,673 bp
  • A to G, chromosome 9 at 82,903,190 bp
  • A to G, chromosome 10 at 23,826,182 bp
  • A to T, chromosome 10 at 94,750,640 bp
  • A to G, chromosome 10 at 107,711,922 bp
  • T to C, chromosome 10 at 128,040,506 bp
  • C to T, chromosome 11 at 59,795,799 bp
  • T to C, chromosome 11 at 86,799,437 bp
  • T to G, chromosome 11 at 89,015,776 bp
  • G to T, chromosome 11 at 97,033,142 bp
  • G to A, chromosome 11 at 100,708,596 bp
  • T to C, chromosome 12 at 11,457,115 bp
  • T to C, chromosome 12 at 110,660,893 bp
  • A to G, chromosome 13 at 100,781,701 bp
  • C to A, chromosome 13 at 113,320,886 bp
  • T to A, chromosome 14 at 20,695,028 bp
  • T to A, chromosome 14 at 51,716,448 bp
  • T to A, chromosome 14 at 54,877,069 bp
  • A to G, chromosome 15 at 16,851,029 bp
  • TGTACCTGTTGCATGGTA to TGTA, chromosome 15 at 36,597,968 bp
  • G to T, chromosome 15 at 82,185,296 bp
  • A to G, chromosome 16 at 56,712,634 bp
  • A to G, chromosome 16 at 87,720,143 bp
  • C to T, chromosome 17 at 32,158,506 bp
  • A to T, chromosome 18 at 37,355,595 bp
  • T to C, chromosome 19 at 6,344,054 bp
  • T to C, chromosome 19 at 13,479,431 bp
  • T to A, chromosome 19 at 46,072,282 bp
  • A to G, chromosome 19 at 57,630,306 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7632 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045720-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.