Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7663Btlr/Mmmh
Stock Number:
045738-MU
Citation ID:
RRID:MMRRC_045738-MU
Other Names:
R7663 (G1)
Major Collection:

Strain Information

Ntf3
Name: neurotrophin 3
Synonyms: NT-3, Ntf-3, NT3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18205
HGNC: HGNC:8023
Homologene: 1896
Slc35a1
Name: solute carrier family 35 (CMP-sialic acid transporter), member 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24060
Homologene: 38181
Ldb1
Name: LIM domain binding 1
Synonyms: CLIM2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16825
HGNC: HGNC:6532
Homologene: 2891
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Pdk1
Name: pyruvate dehydrogenase kinase, isoenzyme 1
Synonyms: D530020C15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228026
HGNC: HGNC:8809
Homologene: 134437
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,421,160 bp
  • G to A, chromosome 1 at 64,883,208 bp
  • A to C, chromosome 1 at 162,836,297 bp
  • C to A, chromosome 1 at 172,588,038 bp
  • T to C, chromosome 1 at 179,790,314 bp
  • A to T, chromosome 1 at 181,752,155 bp
  • T to A, chromosome 2 at 42,653,035 bp
  • T to A, chromosome 2 at 52,230,047 bp
  • G to A, chromosome 2 at 71,875,398 bp
  • G to C, chromosome 2 at 88,683,352 bp
  • A to G, chromosome 2 at 146,418,415 bp
  • A to T, chromosome 2 at 164,857,006 bp
  • A to G, chromosome 3 at 89,345,806 bp
  • T to C, chromosome 3 at 96,559,837 bp
  • A to G, chromosome 3 at 138,066,126 bp
  • T to A, chromosome 3 at 144,737,036 bp
  • A to T, chromosome 4 at 34,675,493 bp
  • C to A, chromosome 4 at 117,213,741 bp
  • G to A, chromosome 4 at 120,935,126 bp
  • A to T, chromosome 4 at 142,104,898 bp
  • T to A, chromosome 4 at 154,991,162 bp
  • C to A, chromosome 5 at 121,324,031 bp
  • T to C, chromosome 5 at 128,747,433 bp
  • T to C, chromosome 5 at 147,655,120 bp
  • C to T, chromosome 6 at 42,310,063 bp
  • C to A, chromosome 6 at 121,861,220 bp
  • A to G, chromosome 6 at 126,101,815 bp
  • C to T, chromosome 6 at 142,459,485 bp
  • T to C, chromosome 7 at 27,911,685 bp
  • G to T, chromosome 7 at 28,423,500 bp
  • T to A, chromosome 7 at 42,927,042 bp
  • G to A, chromosome 7 at 56,136,685 bp
  • T to C, chromosome 7 at 103,212,445 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • C to T, chromosome 8 at 41,341,627 bp
  • A to T, chromosome 8 at 121,887,535 bp
  • T to A, chromosome 9 at 100,738,138 bp
  • A to T, chromosome 9 at 107,998,772 bp
  • A to T, chromosome 10 at 7,775,362 bp
  • C to T, chromosome 10 at 68,098,587 bp
  • T to C, chromosome 10 at 70,946,590 bp
  • T to A, chromosome 10 at 79,479,122 bp
  • T to A, chromosome 10 at 80,904,739 bp
  • A to G, chromosome 10 at 85,899,281 bp
  • T to A, chromosome 10 at 100,554,536 bp
  • T to A, chromosome 10 at 130,472,185 bp
  • T to C, chromosome 11 at 23,742,713 bp
  • T to C, chromosome 11 at 29,498,614 bp
  • C to T, chromosome 11 at 34,721,027 bp
  • G to T, chromosome 11 at 97,712,492 bp
  • T to C, chromosome 11 at 116,852,294 bp
  • C to A, chromosome 12 at 84,069,581 bp
  • A to C, chromosome 12 at 84,606,129 bp
  • T to C, chromosome 12 at 112,913,666 bp
  • T to C, chromosome 12 at 114,059,934 bp
  • C to T, chromosome 13 at 22,244,741 bp
  • A to G, chromosome 13 at 23,232,431 bp
  • A to G, chromosome 13 at 67,683,401 bp
  • A to C, chromosome 14 at 6,675,701 bp
  • T to A, chromosome 14 at 103,191,609 bp
  • T to C, chromosome 15 at 3,988,683 bp
  • A to G, chromosome 15 at 12,373,203 bp
  • T to A, chromosome 15 at 39,507,026 bp
  • T to C, chromosome 15 at 59,651,713 bp
  • T to G, chromosome 15 at 99,945,069 bp
  • T to C, chromosome 15 at 101,931,843 bp
  • T to C, chromosome 17 at 33,433,469 bp
  • T to A, chromosome 17 at 67,780,880 bp
  • T to C, chromosome 18 at 47,086,256 bp
  • G to T, chromosome 19 at 13,530,445 bp
  • A to T, chromosome 19 at 39,877,509 bp
  • T to C, chromosome 19 at 46,035,524 bp
  • C to T, chromosome X at 8,962,804 bp
  • C to T, chromosome X at 8,962,808 bp
  • G to A, chromosome X at 136,927,722 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7663 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045738-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.