Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7714Btlr/Mmmh
Stock Number:
045772-MU
Citation ID:
RRID:MMRRC_045772-MU
Other Names:
R7714 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Gapdhs
Name: glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Synonyms: Gapd-s, Gapds
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14447
Homologene: 101265
Rad51c
Name: RAD51 paralog C
Synonyms: Rad51l2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 114714
HGNC: HGNC:9820
Homologene: 14238
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 36,401,477 bp
  • T to A, chromosome 1 at 37,624,777 bp
  • C to T, chromosome 1 at 74,679,413 bp
  • T to C, chromosome 1 at 74,784,263 bp
  • A to G, chromosome 1 at 92,917,168 bp
  • C to T, chromosome 1 at 132,456,876 bp
  • G to A, chromosome 1 at 174,042,334 bp
  • A to T, chromosome 2 at 5,229,097 bp
  • T to A, chromosome 2 at 31,922,267 bp
  • T to C, chromosome 3 at 59,093,586 bp
  • A to C, chromosome 3 at 79,518,114 bp
  • A to G, chromosome 3 at 118,804,131 bp
  • A to T, chromosome 3 at 125,570,844 bp
  • G to A, chromosome 4 at 32,722,360 bp
  • A to G, chromosome 4 at 35,083,872 bp
  • T to C, chromosome 4 at 63,324,486 bp
  • G to A, chromosome 4 at 123,295,309 bp
  • T to A, chromosome 4 at 128,382,950 bp
  • C to A, chromosome 4 at 156,195,397 bp
  • A to G, chromosome 5 at 8,117,587 bp
  • A to G, chromosome 5 at 25,375,366 bp
  • A to G, chromosome 5 at 30,370,253 bp
  • C to T, chromosome 5 at 91,593,932 bp
  • A to T, chromosome 5 at 92,302,679 bp
  • T to C, chromosome 5 at 110,841,453 bp
  • C to T, chromosome 5 at 115,595,300 bp
  • C to T, chromosome 5 at 124,637,595 bp
  • C to T, chromosome 5 at 137,835,417 bp
  • T to C, chromosome 6 at 42,435,097 bp
  • A to C, chromosome 6 at 145,815,247 bp
  • T to A, chromosome 7 at 8,908,117 bp
  • A to C, chromosome 7 at 12,606,491 bp
  • A to T, chromosome 7 at 27,364,336 bp
  • A to C, chromosome 7 at 29,185,482 bp
  • A to T, chromosome 7 at 30,731,924 bp
  • A to T, chromosome 7 at 62,378,382 bp
  • A to G, chromosome 9 at 22,250,515 bp
  • A to C, chromosome 10 at 49,419,696 bp
  • G to A, chromosome 10 at 61,300,155 bp
  • T to A, chromosome 10 at 63,002,993 bp
  • T to C, chromosome 10 at 88,091,380 bp
  • T to C, chromosome 11 at 11,802,842 bp
  • T to C, chromosome 11 at 75,658,693 bp
  • T to C, chromosome 11 at 87,401,450 bp
  • A to G, chromosome 11 at 95,265,290 bp
  • T to C, chromosome 11 at 96,345,780 bp
  • T to C, chromosome 11 at 103,616,893 bp
  • T to C, chromosome 11 at 120,729,802 bp
  • T to A, chromosome 12 at 10,375,472 bp
  • C to A, chromosome 12 at 38,630,593 bp
  • T to A, chromosome 12 at 40,725,649 bp
  • T to C, chromosome 12 at 86,691,840 bp
  • A to G, chromosome 14 at 32,805,172 bp
  • A to G, chromosome 14 at 52,778,923 bp
  • G to A, chromosome 14 at 53,757,898 bp
  • A to T, chromosome 15 at 83,308,151 bp
  • G to A, chromosome 15 at 99,722,086 bp
  • A to T, chromosome 16 at 21,766,390 bp
  • A to T, chromosome 16 at 59,558,873 bp
  • C to A, chromosome 16 at 87,718,848 bp
  • C to T, chromosome 17 at 24,550,276 bp
  • A to T, chromosome 18 at 32,090,515 bp
  • T to C, chromosome 18 at 42,560,935 bp
  • GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA, chromosome 18 at 57,293,999 bp
  • T to C, chromosome 18 at 89,247,309 bp
  • A to T, chromosome 19 at 13,445,888 bp
  • G to A, chromosome 19 at 33,965,648 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7714 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045772-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.