Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7729Btlr/Mmmh
Stock Number:
045785-MU
Citation ID:
RRID:MMRRC_045785-MU
Other Names:
R7729 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Abce1
Name: ATP-binding cassette, sub-family E member 1
Synonyms: RNS4l (Eye), Oabp, Rnaseli
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24015
HGNC: HGNC:69
Homologene: 2205
Oxr1
Name: oxidation resistance 1
Synonyms: C7B, C7, 2210416C20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Pdia3
Name: protein disulfide isomerase associated 3
Synonyms: ERp61, ERp60, ERp57, PDI-Q2, Plca, Erp, Grp58, PDI
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14827
HGNC: HGNC:4606
Homologene: 68454
Trip10
Name: thyroid hormone receptor interactor 10
Synonyms: Cip4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106628
VEGA: 17
Homologene: 99728
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 6,802,537 bp
  • C to A, chromosome 1 at 21,384,841 bp
  • T to C, chromosome 1 at 75,184,560 bp
  • A to T, chromosome 1 at 98,497,523 bp
  • T to C, chromosome 1 at 155,312,872 bp
  • T to A, chromosome 1 at 185,413,169 bp
  • C to A, chromosome 1 at 186,630,757 bp
  • A to G, chromosome 1 at 192,101,778 bp
  • T to G, chromosome 2 at 36,301,760 bp
  • T to C, chromosome 2 at 121,093,710 bp
  • A to G, chromosome 2 at 121,432,357 bp
  • T to G, chromosome 2 at 127,186,790 bp
  • A to G, chromosome 3 at 35,778,107 bp
  • T to A, chromosome 3 at 86,318,167 bp
  • A to G, chromosome 3 at 142,726,305 bp
  • C to T, chromosome 4 at 6,378,985 bp
  • T to A, chromosome 4 at 40,206,034 bp
  • G to A, chromosome 4 at 99,055,446 bp
  • C to T, chromosome 4 at 103,214,847 bp
  • T to C, chromosome 4 at 108,691,776 bp
  • C to T, chromosome 4 at 129,992,124 bp
  • T to C, chromosome 4 at 144,392,864 bp
  • T to C, chromosome 4 at 145,075,052 bp
  • A to G, chromosome 5 at 115,984,822 bp
  • A to G, chromosome 5 at 120,886,000 bp
  • T to C, chromosome 5 at 122,491,766 bp
  • T to A, chromosome 5 at 147,700,367 bp
  • T to A, chromosome 6 at 61,311,856 bp
  • A to T, chromosome 6 at 69,184,970 bp
  • T to A, chromosome 6 at 83,183,060 bp
  • T to C, chromosome 6 at 121,383,981 bp
  • A to C, chromosome 7 at 3,228,388 bp
  • T to C, chromosome 7 at 31,053,471 bp
  • T to C, chromosome 7 at 45,095,373 bp
  • T to A, chromosome 7 at 97,301,426 bp
  • CGGCGGCGG to CGGCGGCGGGGGCGGCGG, chromosome 7 at 97,579,911 bp
  • C to T, chromosome 7 at 102,098,504 bp
  • A to T, chromosome 7 at 105,705,265 bp
  • ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG to ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG, chromosome 7 at 142,296,596 bp
  • A to G, chromosome 8 at 25,037,077 bp
  • T to C, chromosome 8 at 33,324,426 bp
  • C to A, chromosome 8 at 71,558,802 bp
  • A to T, chromosome 8 at 79,687,908 bp
  • A to T, chromosome 8 at 107,040,897 bp
  • G to A, chromosome 9 at 39,238,250 bp
  • G to A, chromosome 9 at 39,599,775 bp
  • C to T, chromosome 9 at 45,858,445 bp
  • A to G, chromosome 9 at 118,556,063 bp
  • G to T, chromosome 9 at 119,495,540 bp
  • T to C, chromosome 10 at 81,587,147 bp
  • T to A, chromosome 10 at 105,766,010 bp
  • A to C, chromosome 11 at 23,449,268 bp
  • A to G, chromosome 11 at 84,371,513 bp
  • A to G, chromosome 11 at 86,721,648 bp
  • C to T, chromosome 12 at 17,424,675 bp
  • T to A, chromosome 12 at 37,414,975 bp
  • A to G, chromosome 13 at 23,696,472 bp
  • C to T, chromosome 13 at 59,741,623 bp
  • T to C, chromosome 13 at 67,182,220 bp
  • A to G, chromosome 14 at 53,491,507 bp
  • C to A, chromosome 14 at 60,974,734 bp
  • C to A, chromosome 14 at 63,240,737 bp
  • C to T, chromosome 15 at 11,986,503 bp
  • G to A, chromosome 15 at 41,823,467 bp
  • C to T, chromosome 16 at 59,149,207 bp
  • C to T, chromosome 17 at 25,723,517 bp
  • T to C, chromosome 17 at 32,333,094 bp
  • G to A, chromosome 17 at 57,262,442 bp
  • C to A, chromosome 18 at 33,854,273 bp
  • A to G, chromosome 19 at 8,593,959 bp
  • A to G, chromosome 19 at 8,914,712 bp
  • A to T, chromosome 19 at 41,952,465 bp
  • G to A, chromosome 19 at 55,192,672 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7729 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045785-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.