Strain Name:
C57BL/6J-MtgxR7729Btlr/Mmmh
Stock Number:
045785-MU
Citation ID:
RRID:MMRRC_045785-MU
Other Names:
R7729 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Abce1
Name: ATP-binding cassette, sub-family E member 1
Synonyms: Rnaseli, Oabp, RNS4l (Eye)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24015
HGNC: HGNC:69
Homologene: 2205
Oxr1
Name: oxidation resistance 1
Synonyms: C7, C7B, 2210416C20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Pdia3
Name: protein disulfide isomerase associated 3
Synonyms: ERp57, Plca, Erp, ERp61, Grp58, PDI, PDI-Q2, ERp60
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14827
HGNC: HGNC:4606
Homologene: 68454
Trip10
Name: thyroid hormone receptor interactor 10
Synonyms: Cip4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106628
VEGA: 17
Homologene: 99728
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Atp2a2
Name: ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Synonyms: sarco/endoplasmic reticulum Ca2+-ATPase 2, SERCA2B, 9530097L16Rik, Serca2a, D5Wsu150e, SERCA2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11938
HGNC: HGNC:812
Homologene: 80167
Golga4
Name: golgin A4
Synonyms: golgin-245, Olp-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54214
HGNC: HGNC:4427
Homologene: 68224
Eprs1
Name: glutamyl-prolyl-tRNA synthetase 1
Synonyms: 2410081F06Rik, Eprs, Qprs, 3010002K18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107508
HGNC: HGNC:3418
Homologene: 5870
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Dctn1
Name: dynactin 1
Synonyms: Glued, p150glued, p150
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13191
HGNC: HGNC:2711
Homologene: 3011
Mms19
Name: MMS19 cytosolic iron-sulfur assembly component
Synonyms: 2610042O15Rik, Mms19, Mms19l, C86341
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72199
Homologene: 41480
Sub1
Name: SUB1 homolog, transcriptional regulator
Synonyms: Pc4, Rpo2tc1, P15
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20024
Homologene: 38218
Nol10
Name: nucleolar protein 10
Synonyms: LOC217431
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217431
VEGA: 12
Homologene: 5998
Rsf1
Name: remodeling and spacing factor 1
Synonyms: Hbxap, p325, 4832420A03Rik, XAP8, C030033M12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Mettl25
Name: methyltransferase like 25
Synonyms: BC067068
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216292
Homologene: 32774
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: Murr2, A530081C03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Akap8l
Name: A kinase anchor protein 8-like
Synonyms: Nakap95
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54194
VEGA: 17
Homologene: 8658
Cit
Name: citron
Synonyms: Cit-k, CRIK-SK, citron-N, citron kinase, C030025P15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
Adgrb2
Name: adhesion G protein-coupled receptor B2
Synonyms: Bai2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230775
HGNC: HGNC:944
Homologene: 1288
Dock7
Name: dedicator of cytokinesis 7
Synonyms: 3110056M06Rik, m, LOC242555
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67299
Homologene: 23566
Iqsec3
Name: IQ motif and Sec7 domain 3
Synonyms: BRAG3, synarfGEF
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243621
Homologene: 46091
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: LOC327983, acetyl-CoA carboxylase, Acac, A530025K05Rik, Acc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Ganab
Name: alpha glucosidase 2 alpha neutral subunit
Synonyms: GluII, G2an
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14376
VEGA: 19
HGNC: HGNC:4138
Homologene: 5426
Gab2
Name: growth factor receptor bound protein 2-associated protein 2
Synonyms: p97, D130058I17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14389
Homologene: 69067
Vps4a
Name: vacuolar protein sorting 4A
Synonyms: 4930589C15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 116733
Homologene: 69132
Tnfrsf19
Name: tumor necrosis factor receptor superfamily, member 19
Synonyms: TRADE, TAJ-ALPHA, Troy, TAJ
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 29820
VEGA: 14
Homologene: 8481
Gata4
Name: GATA binding protein 4
Synonyms: Gata-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14463
HGNC: HGNC:4173
Homologene: 1551
Khdc1b
Name: KH domain containing 1B
Synonyms: Khdc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98582
Homologene: 134524
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Slc35d1
Name: solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1
Synonyms: UGTREL7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242585
Homologene: 22870
Zfyve9
Name: zinc finger, FYVE domain containing 9
Synonyms: Madhip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230597
HGNC: HGNC:6775
Homologene: 3527
Flt1
Name: FMS-like tyrosine kinase 1
Synonyms: sFlt1, VEGFR-1, VEGFR1, Flt-1, vascular endothelial growth factor receptor-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14254
HGNC: HGNC:3763
Homologene: 134179
Xpr1
Name: xenotropic and polytropic retrovirus receptor 1
Synonyms: Rmc-1, Rmc1, suppressor of yeast Ga deletion, Syg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19775
Homologene: 134226
Ccser1
Name: coiled-coil serine rich 1
Synonyms: 6230405M12Rik, C130092O11Rik, Fam190a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232035
Homologene: 28086
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5, mH1, SkM2, Nav1.5c
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Nlrp12
Name: NLR family, pyrin domain containing 12
Synonyms: Nalp12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 378425
Homologene: 16972
Atp11b
Name: ATPase, class VI, type 11B
Synonyms: 1110019I14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76295
Homologene: 32919
Chtf18
Name: CTF18, chromosome transmission fidelity factor 18
Synonyms: 6030457M03Rik, CTF18
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214901
Homologene: 32532
Atg9a
Name: autophagy related 9A
Synonyms: Apg9l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 245860
Homologene: 34495
Htra4
Name: HtrA serine peptidase 4
Synonyms: B430206E18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330723
Homologene: 17801
Tgm7
Name: transglutaminase 7
Synonyms: TGz
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 640543
Homologene: 14192
Bace1
Name: beta-site APP cleaving enzyme 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23821
HGNC: HGNC:933
Homologene: 8014
Or5k3
Name: olfactory receptor family 5 subfamily K member 3
Synonyms: MOR184-5, Olfr195, GA_x54KRFPKG5P-55369823-55370749
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259000
Homologene: 128109
St18
Name: suppression of tumorigenicity 18
Synonyms: Nzf3, Myt3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240690
Homologene: 8792
Rsl1
Name: regulator of sex limited protein 1
Synonyms: rslcan-9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380855
Homologene: 110878
Tectb
Name: tectorin beta
Synonyms: Tctnb, [b]-tectorin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21684
Homologene: 7568
Sdcbp
Name: syndecan binding protein
Synonyms: syntenin, syntenin-1, syndecan interacting protein, MDA-9, Sycl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53378
Homologene: 4110
H1f6
Name: H1.6 linker histone, cluster member
Synonyms: Hist1h1t, H1t, H1ft
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107970
HGNC: HGNC:4720
Homologene: 3889
Rigi
Name: RNA sensor RIG-I
Synonyms: 6430573D20Rik, RIG-I, DEAD (Asp-Glu-Ala-Asp) box polypeptide 58, Ddx58
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230073
Homologene: 32215
Slco6d1
Name: solute carrier organic anion transporter family, member 6d1
Synonyms: 4921511I05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70866
Homologene: 86643
Slc22a8
Name: solute carrier family 22 (organic anion transporter), member 8
Synonyms: Roct, OAT3, mOat3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19879
VEGA: 19
Homologene: 20901
Fcgrt
Name: Fc fragment of IgG receptor and transporter
Synonyms: FcRn, neonatal Fc receptor
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14132
HGNC: HGNC:3621
Homologene: 3030
Oas1g
Name: 2'-5' oligoadenylate synthetase 1G
Synonyms: Oias1, Mmu-L, Mmu-L2, Oas1a, L2, Oias-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23960
HGNC: HGNC:8086
Homologene: 1903
Tle2
Name: transducin-like enhancer of split 2
Synonyms: Grg2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21886
Homologene: 20693
Rcor3
Name: REST corepressor 3
Synonyms: E130101E15Rik, 4921514E24Rik, C730034D20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214742
Homologene: 135671
Art5
Name: ADP-ribosyltransferase 5
Synonyms: Yac-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11875
Homologene: 7231
Agmo
Name: alkylglycerol monooxygenase
Synonyms: A530016O06Rik, Tmem195
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319660
Homologene: 45620
Spata31d1e
Name: spermatogenesis associated 31 subfamily D, member 1E
Synonyms: 1700014D04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 102638268
Homologene: 140986
Kyat3
Name: kynurenine aminotransferase 3
Synonyms: KATIII, Kat3, Ccbl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229905
Homologene: 2994
Tgfb2
Name: transforming growth factor, beta 2
Synonyms: Tgf-beta2, Tgfb-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21808
Homologene: 2432
Tmem221
Name: transmembrane protein 221
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434325
Homologene: 110174
Fxyd1
Name: FXYD domain-containing ion transport regulator 1
Synonyms: phospholemman, PLM, PML, 0610012C17Rik, 1110006M24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56188
HGNC: HGNC:4025
Homologene: 3691
Or8g18
Name: olfactory receptor family 8 subfamily G member 18
Synonyms: Olfr1537-ps1, Olfr144, K4, MOR171-32P, GA_x6K02T2PVTD-32935684-32934749, MOR171-32P, Olfr1537, MOR171-41P
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257959
VEGA: 9
HGNC: HGNC:8484
Homologene: 110610
Trav6-5
Name: T cell receptor alpha variable 6-5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100126464
Or1j8
Name: olfactory receptor family 1 subfamily J member 8
Synonyms: GA_x6K02T2NLDC-33001193-33002131, Olfr335-ps, MOR137-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 666118
Igkv4-74
Name: immunoglobulin kappa variable 4-74
Synonyms: 236047, Gm10880
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 236047
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 6,802,537 bp
  • C to A, chromosome 1 at 21,384,841 bp
  • T to C, chromosome 1 at 75,184,560 bp
  • A to T, chromosome 1 at 98,497,523 bp
  • T to C, chromosome 1 at 155,312,872 bp
  • T to A, chromosome 1 at 185,413,169 bp
  • C to A, chromosome 1 at 186,630,757 bp
  • A to G, chromosome 1 at 192,101,778 bp
  • T to G, chromosome 2 at 36,301,760 bp
  • T to C, chromosome 2 at 121,093,710 bp
  • A to G, chromosome 2 at 121,432,357 bp
  • T to G, chromosome 2 at 127,186,790 bp
  • A to G, chromosome 3 at 35,778,107 bp
  • T to A, chromosome 3 at 86,318,167 bp
  • A to G, chromosome 3 at 142,726,305 bp
  • C to T, chromosome 4 at 6,378,985 bp
  • T to A, chromosome 4 at 40,206,034 bp
  • G to A, chromosome 4 at 99,055,446 bp
  • C to T, chromosome 4 at 103,214,847 bp
  • T to C, chromosome 4 at 108,691,776 bp
  • C to T, chromosome 4 at 129,992,124 bp
  • T to C, chromosome 4 at 144,392,864 bp
  • T to C, chromosome 4 at 145,075,052 bp
  • A to G, chromosome 5 at 115,984,822 bp
  • A to G, chromosome 5 at 120,886,000 bp
  • T to C, chromosome 5 at 122,491,766 bp
  • T to A, chromosome 5 at 147,700,367 bp
  • T to A, chromosome 6 at 61,311,856 bp
  • A to T, chromosome 6 at 69,184,970 bp
  • T to A, chromosome 6 at 83,183,060 bp
  • T to C, chromosome 6 at 121,383,981 bp
  • A to C, chromosome 7 at 3,228,388 bp
  • T to C, chromosome 7 at 31,053,471 bp
  • T to C, chromosome 7 at 45,095,373 bp
  • T to A, chromosome 7 at 97,301,426 bp
  • CGGCGGCGG to CGGCGGCGGGGGCGGCGG, chromosome 7 at 97,579,911 bp
  • C to T, chromosome 7 at 102,098,504 bp
  • A to T, chromosome 7 at 105,705,265 bp
  • ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG to ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG, chromosome 7 at 142,296,596 bp
  • A to G, chromosome 8 at 25,037,077 bp
  • T to C, chromosome 8 at 33,324,426 bp
  • C to A, chromosome 8 at 71,558,802 bp
  • A to T, chromosome 8 at 79,687,908 bp
  • A to T, chromosome 8 at 107,040,897 bp
  • G to A, chromosome 9 at 39,238,250 bp
  • G to A, chromosome 9 at 39,599,775 bp
  • C to T, chromosome 9 at 45,858,445 bp
  • A to G, chromosome 9 at 118,556,063 bp
  • G to T, chromosome 9 at 119,495,540 bp
  • T to C, chromosome 10 at 81,587,147 bp
  • T to A, chromosome 10 at 105,766,010 bp
  • A to C, chromosome 11 at 23,449,268 bp
  • A to G, chromosome 11 at 84,371,513 bp
  • A to G, chromosome 11 at 86,721,648 bp
  • C to T, chromosome 12 at 17,424,675 bp
  • T to A, chromosome 12 at 37,414,975 bp
  • A to G, chromosome 13 at 23,696,472 bp
  • C to T, chromosome 13 at 59,741,623 bp
  • T to C, chromosome 13 at 67,182,220 bp
  • A to G, chromosome 14 at 53,491,507 bp
  • C to A, chromosome 14 at 60,974,734 bp
  • C to A, chromosome 14 at 63,240,737 bp
  • C to T, chromosome 15 at 11,986,503 bp
  • G to A, chromosome 15 at 41,823,467 bp
  • C to T, chromosome 16 at 59,149,207 bp
  • C to T, chromosome 17 at 25,723,517 bp
  • T to C, chromosome 17 at 32,333,094 bp
  • G to A, chromosome 17 at 57,262,442 bp
  • C to A, chromosome 18 at 33,854,273 bp
  • A to G, chromosome 19 at 8,593,959 bp
  • A to G, chromosome 19 at 8,914,712 bp
  • A to T, chromosome 19 at 41,952,465 bp
  • G to A, chromosome 19 at 55,192,672 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7729 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045785-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.