Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7814Btlr/Mmmh
Stock Number:
045869-MU
Citation ID:
RRID:MMRRC_045869-MU
Other Names:
R7814 (G1)
Major Collection:

Strain Information

Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: C78091, Unrip
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20901
Homologene: 43881
Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Ins2
Name: insulin II
Synonyms: Ins-2, Mody4, Mody, InsII
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16334
HGNC: HGNC:6081
Homologene: 173
Rgs7
Name: regulator of G protein signaling 7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 24012
Homologene: 2193
Dbh
Name: dopamine beta hydroxylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13166
HGNC: HGNC:2689
Homologene: 615
Rfx3
Name: regulatory factor X, 3 (influences HLA class II expression)
Synonyms: MRFX3, C230093O12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19726
HGNC: HGNC:9984
Homologene: 7917
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 55,078,644 bp
  • A to G, chromosome 1 at 58,085,467 bp
  • T to A, chromosome 1 at 65,116,691 bp
  • T to A, chromosome 1 at 175,076,069 bp
  • G to C, chromosome 1 at 182,492,146 bp
  • A to T, chromosome 2 at 26,996,549 bp
  • A to T, chromosome 2 at 27,174,848 bp
  • T to C, chromosome 2 at 36,376,809 bp
  • A to G, chromosome 2 at 52,137,380 bp
  • A to T, chromosome 2 at 72,223,117 bp
  • T to C, chromosome 2 at 80,292,960 bp
  • A to G, chromosome 2 at 88,499,072 bp
  • C to A, chromosome 2 at 129,125,544 bp
  • T to C, chromosome 2 at 144,522,564 bp
  • C to T, chromosome 2 at 150,409,482 bp
  • A to C, chromosome 2 at 163,918,628 bp
  • A to G, chromosome 2 at 178,470,035 bp
  • G to A, chromosome 3 at 18,097,302 bp
  • A to G, chromosome 3 at 29,686,791 bp
  • G to A, chromosome 3 at 83,056,837 bp
  • G to T, chromosome 3 at 94,465,855 bp
  • A to G, chromosome 3 at 98,810,943 bp
  • C to T, chromosome 4 at 34,716,347 bp
  • T to G, chromosome 4 at 66,841,079 bp
  • C to T, chromosome 4 at 124,850,602 bp
  • T to C, chromosome 4 at 142,210,170 bp
  • T to C, chromosome 4 at 152,524,272 bp
  • G to T, chromosome 4 at 152,544,403 bp
  • G to T, chromosome 5 at 24,545,422 bp
  • A to T, chromosome 5 at 109,427,873 bp
  • T to A, chromosome 5 at 137,463,579 bp
  • T to C, chromosome 5 at 138,174,817 bp
  • T to A, chromosome 6 at 3,374,793 bp
  • A to G, chromosome 6 at 137,741,978 bp
  • A to T, chromosome 7 at 18,606,914 bp
  • A to T, chromosome 7 at 19,080,843 bp
  • G to A, chromosome 7 at 27,129,253 bp
  • A to C, chromosome 7 at 45,352,262 bp
  • T to A, chromosome 7 at 45,706,990 bp
  • A to G, chromosome 7 at 83,670,140 bp
  • T to C, chromosome 7 at 85,007,264 bp
  • T to A, chromosome 7 at 111,033,927 bp
  • A to T, chromosome 7 at 139,019,129 bp
  • C to A, chromosome 7 at 142,679,586 bp
  • G to T, chromosome 8 at 4,243,744 bp
  • T to C, chromosome 8 at 78,698,573 bp
  • T to C, chromosome 8 at 92,850,170 bp
  • A to G, chromosome 8 at 125,671,611 bp
  • T to C, chromosome 9 at 49,003,918 bp
  • T to C, chromosome 9 at 65,324,301 bp
  • A to G, chromosome 10 at 20,334,619 bp
  • A to T, chromosome 10 at 52,096,137 bp
  • A to T, chromosome 10 at 62,937,420 bp
  • G to A, chromosome 10 at 69,986,904 bp
  • CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC to CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC, chromosome 10 at 128,290,728 bp
  • A to T, chromosome 11 at 62,333,926 bp
  • T to A, chromosome 11 at 66,005,660 bp
  • T to A, chromosome 11 at 87,775,524 bp
  • T to G, chromosome 11 at 100,875,027 bp
  • T to A, chromosome 11 at 103,614,173 bp
  • T to C, chromosome 12 at 4,658,561 bp
  • T to A, chromosome 12 at 53,140,961 bp
  • C to T, chromosome 12 at 100,879,043 bp
  • T to A, chromosome 13 at 23,482,806 bp
  • C to A, chromosome 13 at 54,091,231 bp
  • A to T, chromosome 13 at 54,660,961 bp
  • A to G, chromosome 14 at 12,376,706 bp
  • G to A, chromosome 14 at 27,100,117 bp
  • G to C, chromosome 14 at 33,410,877 bp
  • T to C, chromosome 14 at 43,783,646 bp
  • T to A, chromosome 14 at 51,574,035 bp
  • T to C, chromosome 14 at 55,109,735 bp
  • C to A, chromosome 14 at 66,110,229 bp
  • T to A, chromosome 14 at 70,225,015 bp
  • C to A, chromosome 14 at 70,895,970 bp
  • A to T, chromosome 15 at 31,020,728 bp
  • A to T, chromosome 15 at 78,851,333 bp
  • T to G, chromosome 15 at 82,131,523 bp
  • A to G, chromosome 15 at 83,547,909 bp
  • G to A, chromosome 15 at 99,944,664 bp
  • T to C, chromosome 16 at 13,811,589 bp
  • A to T, chromosome 16 at 33,210,061 bp
  • T to C, chromosome 16 at 58,824,002 bp
  • T to A, chromosome 16 at 93,799,971 bp
  • A to G, chromosome 16 at 96,162,557 bp
  • T to A, chromosome 17 at 37,610,656 bp
  • T to A, chromosome 18 at 20,338,515 bp
  • A to G, chromosome 18 at 34,272,539 bp
  • A to T, chromosome 18 at 46,167,624 bp
  • C to A, chromosome 19 at 11,750,187 bp
  • T to A, chromosome 19 at 27,826,070 bp
  • A to C, chromosome 19 at 34,950,955 bp
  • T to C, chromosome 19 at 40,727,447 bp
  • T to C, chromosome 19 at 43,854,176 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7814 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045869-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.