Strain Name:
C57BL/6J-MtgxR7814Btlr/Mmmh
Stock Number:
045869-MU
Citation ID:
RRID:MMRRC_045869-MU
Other Names:
R7814 (G1)
Major Collection:

Strain Information

Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: C78091, Unrip
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20901
Homologene: 43881
Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Ins2
Name: insulin II
Synonyms: Mody, InsII, Mody4, Ins-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16334
HGNC: HGNC:6081
Homologene: 173
Rgs7
Name: regulator of G protein signaling 7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 24012
Homologene: 2193
Dbh
Name: dopamine beta hydroxylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13166
HGNC: HGNC:2689
Homologene: 615
Rfx3
Name: regulatory factor X, 3 (influences HLA class II expression)
Synonyms: MRFX3, C230093O12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19726
HGNC: HGNC:9984
Homologene: 7917
Mapk8
Name: mitogen-activated protein kinase 8
Synonyms: Prkm8, JNK1, c-Jun N-terminal kinase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26419
HGNC: HGNC:6881
Homologene: 56760
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Il17rd
Name: interleukin 17 receptor D
Synonyms: Sef, Sef-S, 2810004A10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 171463
VEGA: 14
Homologene: 9717
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Ephx2
Name: epoxide hydrolase 2, cytoplasmic
Synonyms: Eph2, sEH, sEP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13850
VEGA: 14
HGNC: HGNC:3402
Homologene: 37558
Bclaf1
Name: BCL2-associated transcription factor 1
Synonyms: 2610102K23Rik, 5730534O06Rik, 2810454G14Rik, 2700025J07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72567
Homologene: 8832
Usp28
Name: ubiquitin specific peptidase 28
Synonyms: 9830148O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235323
VEGA: 9
Homologene: 10840
Faf2
Name: Fas associated factor family member 2
Synonyms: 2210404D11Rik, Ubxd8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76577
Homologene: 8753
Trim36
Name: tripartite motif-containing 36
Synonyms: Haprin, D18Wsu100e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 28105
VEGA: 18
Homologene: 10275
Kazn
Name: kazrin, periplakin interacting protein
Synonyms: 2310007B04Rik, 9030409G11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71529
Homologene: 16235
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, Mphosph1, magoo, 33cex, C330014J10Rik, Kif20b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Slc10a7
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 7
Synonyms: 2410193C02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76775
Homologene: 81628
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ankyrin-G, Ank-3, Ankyrin-3, 2900054D09Rik, AnkG
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Sfxn1
Name: sideroflexin 1
Synonyms: A930015P12Rik, 2810002O05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14057
VEGA: 13
Homologene: 41494
Osbpl11
Name: oxysterol binding protein-like 11
Synonyms: ORP-11
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106326
Homologene: 23385
Slc25a16
Name: solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16
Synonyms: HGT.1, ML7, 3110021G18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73132
Homologene: 21858
Ap4m1
Name: adaptor-related protein complex AP-4, mu 1
Synonyms: 4930443L05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11781
HGNC: HGNC:574
Homologene: 3467
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: D630020H17Rik, 128kDa, Rpo1-2, RPA116, RPA2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Ctr9
Name: CTR9 homolog, Paf1/RNA polymerase II complex component
Synonyms: Tsbp, Tsp, Sh2bp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22083
Homologene: 40668
Mmp2
Name: matrix metallopeptidase 2
Synonyms: gelatinase A, 72kDa type IV collagenase, GelA, 72kDa gelatinase, Clg4a, MMP-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17390
HGNC: HGNC:7166
Homologene: 3329
Tlr4
Name: toll-like receptor 4
Synonyms: Rasl2-8, Lps, lipopolysaccharide response
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21898
Homologene: 41317
Jph4
Name: junctophilin 4
Synonyms: 9330157P13Rik, JPHL1, JP-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319984
Homologene: 13034
Rrn3
Name: RRN3 RNA polymerase I transcription factor homolog (yeast)
Synonyms: E130302O19Rik, TIF-1A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106298
VEGA: 16
Homologene: 39531
Gpr68
Name: G protein-coupled receptor 68
Synonyms: OGR1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238377
HGNC: HGNC:4519
Homologene: 2603
Hspd1
Name: heat shock protein 1 (chaperonin)
Synonyms: Hsp60
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15510
HGNC: HGNC:5261
Homologene: 1626
Dbp
Name: D site albumin promoter binding protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13170
HGNC: HGNC:2697
Homologene: 1035
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: adenomatosis polyposis coli, CC1, Min
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Itsn2
Name: intersectin 2
Synonyms: Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B, Ese2, Sh3p18
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Lgals2
Name: lectin, galactose-binding, soluble 2
Synonyms: 2200008F12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 107753
VEGA: 15
HGNC: HGNC:6562
Homologene: 4741
Il16
Name: interleukin 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16170
HGNC: HGNC:5980
Homologene: 18157
Gfra2
Name: glial cell line derived neurotrophic factor family receptor alpha 2
Synonyms: GFR alpha 2, GFR alpha-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14586
VEGA: 14
HGNC: HGNC:4244
Homologene: 1145
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, catenin (cadherin associated protein), delta 2, Catnd2, neurojugin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Stat5a
Name: signal transducer and activator of transcription 5A
Synonyms: STAT5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20850
Homologene: 20680
Adamts13
Name: ADAM metallopeptidase with thrombospondin type 1 motif 13
Synonyms: LOC279028, vWF-CP mRNA for von Willebrand factor-cleaving
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 279028
HGNC: HGNC:1366
Homologene: 16372
Cyp7b1
Name: cytochrome P450, family 7, subfamily b, polypeptide 1
Synonyms: hct-1, D3Ertd552e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13123
HGNC: HGNC:2652
Homologene: 3544
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Rapgef4
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: 5730402K07Rik, Epac2, 6330581N18Rik, cAMP-GEFII, 1300003D15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56508
Homologene: 4451
Egfem1
Name: EGF-like and EMI domain containing 1
Synonyms: 6130401L20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75740
Homologene: 135950
Cfap206
Name: cilia and flagella associated protein 206
Synonyms: 1700003M02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69329
Homologene: 18713
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: Dnahc9, D11Ertd686e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: Gm884, LOC380730
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380730
Homologene: 134511
Aox1
Name: aldehyde oxidase 1
Synonyms: retinal oxidase, Aox-2, Aox2, Aox-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11761
HGNC: HGNC:553
Homologene: 68165
Cblif
Name: cobalamin binding intrinsic factor
Synonyms: Gif
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14603
HGNC: HGNC:4268
Homologene: 3773
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Btn2a2
Name: butyrophilin, subfamily 2, member A2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238555
Homologene: 56012
Capn2
Name: calpain 2
Synonyms: Capa2, Capa-2, m-calpain
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12334
HGNC: HGNC:1479
Homologene: 1326
Ccdc134
Name: coiled-coil domain containing 134
Synonyms: 2310042L06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76457
VEGA: 15
Homologene: 77543
Vmn2r66
Name: vomeronasal 2, receptor 66
Synonyms: F830104D24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233437
Homologene: 115466
Stat2
Name: signal transducer and activator of transcription 2
Synonyms: 1600010G07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20847
VEGA: 10
Homologene: 3952
Samd9l
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209086
HGNC: HGNC:1349
Homologene: 7707
Ppp3cc
Name: protein phosphatase 3, catalytic subunit, gamma isoform
Synonyms: Calnc, PP2BA gamma
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19057
VEGA: 14
HGNC: HGNC:9316
Homologene: 68475
Psg23
Name: pregnancy-specific beta-1-glycoprotein 23
Synonyms: 1620401C02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56868
HGNC: HGNC:1819
Homologene: 110989
Rims4
Name: regulating synaptic membrane exocytosis 4
Synonyms: Rim4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241770
Homologene: 18123
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
D630023F18Rik
Name: RIKEN cDNA D630023F18 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98303
Homologene: 129674
Clpx
Name: caseinolytic mitochondrial matrix peptidase chaperone subunit
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270166
HGNC: HGNC:2088
Homologene: 4851
Dmwd
Name: dystrophia myotonica-containing WD repeat motif
Synonyms: Dm9, DMR-N9, 59
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13401
HGNC: HGNC:2936
Homologene: 22559
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: 1700030F18Rik, LOC380973
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Ppfia3
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms: 2410127E16Rik, Liprin-alpha3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76787
HGNC: HGNC:9247
Homologene: 37833
Cdh26
Name: cadherin-like 26
Synonyms: LOC381409
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381409
Homologene: 18643
Nphp4
Name: nephronophthisis 4 (juvenile) homolog (human)
Synonyms: nmf192, 4930564O18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 260305
Homologene: 9024
Iqca1l
Name: IQ motif containing with AAA domain 1 like
Synonyms: 4931409K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231045
Homologene: 18602
Vmn2r17
Name: vomeronasal 2, receptor 17
Synonyms: EG384221
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384221
Homologene: 104825
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207777
Homologene: 37961
Dzank1
Name: double zinc ribbon and ankyrin repeat domains 1
Synonyms: 2810039F03Rik, Ankrd64, 6330439K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241688
Homologene: 10037
Prdx6b
Name: peroxiredoxin 6B
Synonyms: Prdx6-ps1, 4930414C22Rik, Aop2-rs1, 1-cysPrx-P1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320769
Homologene: 71226
Entpd1
Name: ectonucleoside triphosphate diphosphohydrolase 1
Synonyms: Cd39, ectoapyrase, 2610206B08Rik, NTPDase-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12495
HGNC: HGNC:3363
Homologene: 20423
Lca5l
Name: Leber congenital amaurosis 5-like
Synonyms: 4921526F01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 385668
HGNC: HGNC:1255
Homologene: 47978
Cyp2f2
Name: cytochrome P450, family 2, subfamily f, polypeptide 2
Synonyms: Cyp2f
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13107
Homologene: 73898
Or1j10
Name: olfactory receptor family 1 subfamily J member 10
Synonyms: GA_x6K02T2NLDC-33070879-33071799, MOR136-5, Olfr338
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258949
Homologene: 133647
Or5k8
Name: olfactory receptor family 5 subfamily K member 8
Synonyms: MOR184-1, Olfr175-ps1, Olfr174, GA_x54KRFPKG5P-54993816-54992890, GA_x54KRFPKG5P-55026345-55025418, Olfr175, MOR184-10P
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259004
Homologene: 17461
Mcat
Name: malonyl CoA:ACP acyltransferase (mitochondrial)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223722
VEGA: 15
Homologene: 15511
Riiad1
Name: regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
Synonyms: 2310007A19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66353
Homologene: 11955
Plrg1
Name: pleiotropic regulator 1
Synonyms: Tango4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53317
HGNC: HGNC:9089
Homologene: 2004
Map10
Name: microtubule-associated protein 10
Synonyms: 4933403G14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74393
Homologene: 10416
Or14j4
Name: olfactory receptor family 14 subfamily J member 4
Synonyms: Olfr115, GA_x6K02T2PSCP-2070203-2069271, MOR218-11P
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257908
Homologene: 115497
Jakmip3
Name: janus kinase and microtubule interacting protein 3
Synonyms: 6330417G02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74004
Homologene: 90425
Hsd3b6
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 6
Synonyms: 3beta-HSD VI
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15497
Homologene: 133013
Map2k7
Name: mitogen-activated protein kinase kinase 7
Synonyms: Prkmk7, MKK7, 5930412N11Rik, MAP kinase kinase 7, sek2, Jnkk2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26400
HGNC: HGNC:6847
Homologene: 56548
Gm8180
Name: predicted gene 8180
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105242437
Gm17175
Name: predicted gene 17175
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 102641463
1110065P20Rik
Name: RIKEN cDNA 1110065P20 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68920
Or4c99
Name: olfactory receptor family 4 subfamily C member 99
Synonyms: GA_x6K02T2Q125-49986553-49987462, MOR230-11, MOR230-10P, Olfr1185
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258059
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 55,078,644 bp
  • A to G, chromosome 1 at 58,085,467 bp
  • T to A, chromosome 1 at 65,116,691 bp
  • T to A, chromosome 1 at 175,076,069 bp
  • G to C, chromosome 1 at 182,492,146 bp
  • A to T, chromosome 2 at 26,996,549 bp
  • A to T, chromosome 2 at 27,174,848 bp
  • T to C, chromosome 2 at 36,376,809 bp
  • A to G, chromosome 2 at 52,137,380 bp
  • A to T, chromosome 2 at 72,223,117 bp
  • T to C, chromosome 2 at 80,292,960 bp
  • A to G, chromosome 2 at 88,499,072 bp
  • C to A, chromosome 2 at 129,125,544 bp
  • T to C, chromosome 2 at 144,522,564 bp
  • C to T, chromosome 2 at 150,409,482 bp
  • A to C, chromosome 2 at 163,918,628 bp
  • A to G, chromosome 2 at 178,470,035 bp
  • G to A, chromosome 3 at 18,097,302 bp
  • A to G, chromosome 3 at 29,686,791 bp
  • G to A, chromosome 3 at 83,056,837 bp
  • G to T, chromosome 3 at 94,465,855 bp
  • A to G, chromosome 3 at 98,810,943 bp
  • C to T, chromosome 4 at 34,716,347 bp
  • T to G, chromosome 4 at 66,841,079 bp
  • C to T, chromosome 4 at 124,850,602 bp
  • T to C, chromosome 4 at 142,210,170 bp
  • T to C, chromosome 4 at 152,524,272 bp
  • G to T, chromosome 4 at 152,544,403 bp
  • G to T, chromosome 5 at 24,545,422 bp
  • A to T, chromosome 5 at 109,427,873 bp
  • T to A, chromosome 5 at 137,463,579 bp
  • T to C, chromosome 5 at 138,174,817 bp
  • T to A, chromosome 6 at 3,374,793 bp
  • A to G, chromosome 6 at 137,741,978 bp
  • A to T, chromosome 7 at 18,606,914 bp
  • A to T, chromosome 7 at 19,080,843 bp
  • G to A, chromosome 7 at 27,129,253 bp
  • A to C, chromosome 7 at 45,352,262 bp
  • T to A, chromosome 7 at 45,706,990 bp
  • A to G, chromosome 7 at 83,670,140 bp
  • T to C, chromosome 7 at 85,007,264 bp
  • T to A, chromosome 7 at 111,033,927 bp
  • A to T, chromosome 7 at 139,019,129 bp
  • C to A, chromosome 7 at 142,679,586 bp
  • G to T, chromosome 8 at 4,243,744 bp
  • T to C, chromosome 8 at 78,698,573 bp
  • T to C, chromosome 8 at 92,850,170 bp
  • A to G, chromosome 8 at 125,671,611 bp
  • T to C, chromosome 9 at 49,003,918 bp
  • T to C, chromosome 9 at 65,324,301 bp
  • A to G, chromosome 10 at 20,334,619 bp
  • A to T, chromosome 10 at 52,096,137 bp
  • A to T, chromosome 10 at 62,937,420 bp
  • G to A, chromosome 10 at 69,986,904 bp
  • CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC to CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC, chromosome 10 at 128,290,728 bp
  • A to T, chromosome 11 at 62,333,926 bp
  • T to A, chromosome 11 at 66,005,660 bp
  • T to A, chromosome 11 at 87,775,524 bp
  • T to G, chromosome 11 at 100,875,027 bp
  • T to A, chromosome 11 at 103,614,173 bp
  • T to C, chromosome 12 at 4,658,561 bp
  • T to A, chromosome 12 at 53,140,961 bp
  • C to T, chromosome 12 at 100,879,043 bp
  • T to A, chromosome 13 at 23,482,806 bp
  • C to A, chromosome 13 at 54,091,231 bp
  • A to T, chromosome 13 at 54,660,961 bp
  • A to G, chromosome 14 at 12,376,706 bp
  • G to A, chromosome 14 at 27,100,117 bp
  • G to C, chromosome 14 at 33,410,877 bp
  • T to C, chromosome 14 at 43,783,646 bp
  • T to A, chromosome 14 at 51,574,035 bp
  • T to C, chromosome 14 at 55,109,735 bp
  • C to A, chromosome 14 at 66,110,229 bp
  • T to A, chromosome 14 at 70,225,015 bp
  • C to A, chromosome 14 at 70,895,970 bp
  • A to T, chromosome 15 at 31,020,728 bp
  • A to T, chromosome 15 at 78,851,333 bp
  • T to G, chromosome 15 at 82,131,523 bp
  • A to G, chromosome 15 at 83,547,909 bp
  • G to A, chromosome 15 at 99,944,664 bp
  • T to C, chromosome 16 at 13,811,589 bp
  • A to T, chromosome 16 at 33,210,061 bp
  • T to C, chromosome 16 at 58,824,002 bp
  • T to A, chromosome 16 at 93,799,971 bp
  • A to G, chromosome 16 at 96,162,557 bp
  • T to A, chromosome 17 at 37,610,656 bp
  • T to A, chromosome 18 at 20,338,515 bp
  • A to G, chromosome 18 at 34,272,539 bp
  • A to T, chromosome 18 at 46,167,624 bp
  • C to A, chromosome 19 at 11,750,187 bp
  • T to A, chromosome 19 at 27,826,070 bp
  • A to C, chromosome 19 at 34,950,955 bp
  • T to C, chromosome 19 at 40,727,447 bp
  • T to C, chromosome 19 at 43,854,176 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7814 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045869-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.