Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7816Btlr/Mmmh
Stock Number:
045870-MU
Citation ID:
RRID:MMRRC_045870-MU
Other Names:
R7816 (G1)
Major Collection:

Strain Information

S1pr1
Name: sphingosine-1-phosphate receptor 1
Synonyms: S1P1, S1P, Edg1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13609
HGNC: HGNC:3165
Homologene: 1071
Hfe
Name: homeostatic iron regulator
Synonyms: MR2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15216
HGNC: HGNC:4886
Homologene: 88330
Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Pnoc
Name: prepronociceptin
Synonyms: N23K, Npnc1, proorphanin, OFQ/N, N/OFQ
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18155
VEGA: 14
HGNC: HGNC:9163
Homologene: 4537
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Hdac1
Name: histone deacetylase 1
Synonyms: RPD3, HD1, MommeD5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433759
HGNC: HGNC:4852
Homologene: 68426
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 4733401D09Rik, 9630045K08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 52184
Homologene: 12011
Mtmr14
Name: myotubularin related protein 14
Synonyms: 1110061O04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 97287
Homologene: 11203
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Ints1
Name: integrator complex subunit 1
Synonyms: 1110015K06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68510
Homologene: 53111
Map4k4
Name: mitogen-activated protein kinase kinase kinase kinase 4
Synonyms: Nik, 9430080K19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26921
HGNC: HGNC:6866
Homologene: 7442
Ythdf3
Name: YTH N6-methyladenosine RNA binding protein 3
Synonyms: 9130022A11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229096
Homologene: 34991
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Rabgap1
Name: RAB GTPase activating protein 1
Synonyms: Gapcena
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227800
Homologene: 49301
Ptpn21
Name: protein tyrosine phosphatase, non-receptor type 21
Synonyms: PTPD1, PTPRL10
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 24000
VEGA: 12
HGNC: HGNC:9651
Homologene: 5110
Zfp292
Name: zinc finger protein 292
Synonyms: Zn-16, Zn-15, Krox-10, Zfp-15, 9430062L07Rik, 5730450D02Rik, Zfp15
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30046
Homologene: 8493
Cacnb1
Name: calcium channel, voltage-dependent, beta 1 subunit
Synonyms: Cchlb1, Cchb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12295
HGNC: HGNC:1401
Homologene: 20186
Trp53bp2
Name: transformation related protein 53 binding protein 2
Synonyms: ASPP2, 53BP2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 209456
Homologene: 3959
Golga1
Name: golgin A1
Synonyms: golgin-97, 0710001G09Rik, 2210418B03Rik, Golgi97, awag
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76899
HGNC: HGNC:4424
Homologene: 68223
Zfp180
Name: zinc finger protein 180
Synonyms: D130011P11, HHZ168, 2310040I01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210135
Homologene: 8306
Eif4e3
Name: eukaryotic translation initiation factor 4E member 3
Synonyms: eIF4E-3, 1300018P11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66892
Homologene: 41652
Kcnh5
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238271
VEGA: 12
HGNC: HGNC:6254
Homologene: 15858
Rtn4r
Name: reticulon 4 receptor
Synonyms: Nogo-66 receptor, NgR, NgR1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 65079
Homologene: 11299
Ino80d
Name: INO80 complex subunit D
Synonyms: A430093A21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227195
Homologene: 9819
Tbc1d1
Name: TBC1 domain family, member 1
Synonyms: 1110062G02Rik, Nob1, Nobq1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57915
Homologene: 56856
Zfp981
Name: zinc finger protein 981
Synonyms: Gm13247
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041433
Homologene: 133076
Ypel3
Name: yippee like 3
Synonyms: 1190001G19Rik, Suap, 0610043B10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66090
Homologene: 116010
Rpn1
Name: ribophorin I
Synonyms: Rpn-1, D6Wsu137e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 103963
Homologene: 2213
Amotl2
Name: angiomotin-like 2
Synonyms: Lccp, MASCOT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56332
Homologene: 9420
Rrbp1
Name: ribosome binding protein 1
Synonyms: mRRp0, ES/130, p180, mRRp1.8, mRRp2, mRRp5.4, mRRp10, mRRp16.8, mRRp15b, mRRp15a, mRRp41, mRRp47, 5730465C04Rik, 1700087N07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 81910
Homologene: 68138
Glis2
Name: GLIS family zinc finger 2
Synonyms: Nkl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 83396
Homologene: 12821
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: A930007H10Rik, C820010P03Rik, 0910001L17Rik, Ugcgl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320011
Homologene: 10586
Spryd3
Name: SPRY domain containing 3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223918
Homologene: 13138
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Idh2
Name: isocitrate dehydrogenase 2 (NADP+), mitochondrial
Synonyms: Idh-2, IDPm
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269951
HGNC: HGNC:5383
Homologene: 37590
Kcnj11
Name: potassium inwardly rectifying channel, subfamily J, member 11
Synonyms: Kir6.2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16514
HGNC: HGNC:6257
Homologene: 441
Itpkb
Name: inositol 1,4,5-trisphosphate 3-kinase B
Synonyms: 1110033J02Rik, E130307H12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320404
HGNC: HGNC:6179
Homologene: 1672
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Vmn2r103
Name: vomeronasal 2, receptor 103
Synonyms: EG627636
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627636
Homologene: 115024
Cyp2b9
Name: cytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms: Cyp2b, phenobarbitol inducible, type a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13094
HGNC: HGNC:2615
Homologene: 74933
Lyzl6
Name: lysozyme-like 6
Synonyms: 1700023H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69444
Homologene: 10709
Fbxl13
Name: F-box and leucine-rich repeat protein 13
Synonyms: 4921539K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320118
Homologene: 27057
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Jmjd4
Name: jumonji domain containing 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 194952
Homologene: 11306
Ttc21b
Name: tetratricopeptide repeat domain 21B
Synonyms: 2410066K11Rik, line 158, Thm1, aln
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73668
Homologene: 57006
Rwdd4a
Name: RWD domain containing 4A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 192174
Homologene: 16059
F13a1
Name: coagulation factor XIII, A1 subunit
Synonyms: Factor XIIIA, 1200014I03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74145
VEGA: 13
HGNC: HGNC:3531
Homologene: 20077
Trp63
Name: transformation related protein 63
Synonyms: KET protein, p63, p73L, Trp53rp1, TAp63, p51/p63, deltaNp63
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22061
Homologene: 31189
BC005537
Name: cDNA sequence BC005537
Synonyms: 8030460C05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 79555
Homologene: 11551
Rgs17
Name: regulator of G-protein signaling 17
Synonyms: RGSZ2, 6430507P11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56533
Homologene: 8242
Pramel23
Name: PRAME like 23
Synonyms: Gm13089
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277667
Lipo4
Name: lipase, member O4
Synonyms: Gm6857
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 628236
Homologene: 103863
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, Cortbp2, 9130022E09Rik, 4732477G22Rik, 3010022N24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30785
Homologene: 14125
Prss1l
Name: serine protease 1 (trypsin 1) like
Synonyms: Gm5771
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 436523
Homologene: 88408
Lrrc9
Name: leucine rich repeat containing 9
Synonyms: 4930432K16Rik, 4921529O18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78257
Homologene: 12692
Mx2
Name: MX dynamin-like GTPase 2
Synonyms: Mx-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17858
Bcas1
Name: brain enriched myelin associated protein 1
Synonyms: NABC1, 2210416M21Rik, 9030223A09Rik, breast carcinoma amplified sequence 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76960
HGNC: HGNC:974
Homologene: 2714
Stk36
Name: serine/threonine kinase 36
Synonyms: 1700112N14Rik, Fused
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269209
Homologene: 49432
Mks1
Name: MKS transition zone complex subunit 1
Synonyms: B8d3, avc6, Meckel syndrome, type 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380718
HGNC: HGNC:7121
Homologene: 9833
Abcb1a
Name: ATP-binding cassette, sub-family B member 1A
Synonyms: mdr-3, Mdr1a, P-gp, P-glycoprotein, Pgy-3, Pgy3, multiple drug resistant 1a, MDR3, Pgp, Evi32
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18671
HGNC: HGNC:40
Homologene: 55496
Zfp354c
Name: zinc finger protein 354C
Synonyms: Kid3, AJ18, 5330421P20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30944
Homologene: 56606
Csnk2a2ip
Name: casein kinase 2, alpha prime interacting protein
Synonyms: Ckt2, Csnka2ip
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224291
Homologene: 77570
Muc13
Name: mucin 13, epithelial transmembrane
Synonyms: 114/A10, Ly64
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17063
HGNC: HGNC:7511
Homologene: 7822
Crp
Name: C-reactive protein, pentraxin-related
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12944
HGNC: HGNC:2367
Homologene: 128039
Coro2a
Name: coronin, actin binding protein 2A
Synonyms: coronin 4, IR10, 9030208C03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107684
HGNC: HGNC:2255
Homologene: 2546
Dppa1
Name: developmental pluripotency associated 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 347708
Homologene: 52259
Or4l1
Name: olfactory receptor family 4 subfamily L member 1
Synonyms: GA_x6K02T2PMLR-5600424-5599495, MOR247-3P, MOR247-4, Olfr723
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 259147
Homologene: 71986
Cd52
Name: CD52 antigen
Synonyms: MB7, CLS1, B7, CAMPATH-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 23833
HGNC: HGNC:1804
Pou4f3
Name: POU domain, class 4, transcription factor 3
Synonyms: Brn-3.1, Brn3.1, Brn3c
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18998
HGNC: HGNC:9220
Homologene: 2023
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Rarres1
Name: retinoic acid receptor responder (tazarotene induced) 1
Synonyms: 5430417P09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109222
HGNC: HGNC:9867
Homologene: 2166
Ighv1-56
Name: immunoglobulin heavy variable 1-56
Synonyms: Gm16791
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 382695
Gm17174
Name: predicted gene 17174
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 118568150
Homologene: 128452
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 4,347,703 bp
  • G to A, chromosome 1 at 36,163,315 bp
  • A to G, chromosome 1 at 40,014,208 bp
  • A to G, chromosome 1 at 63,086,397 bp
  • A to G, chromosome 1 at 71,292,429 bp
  • G to T, chromosome 1 at 74,611,169 bp
  • T to C, chromosome 1 at 172,698,710 bp
  • T to A, chromosome 1 at 180,413,889 bp
  • A to G, chromosome 1 at 182,448,695 bp
  • G to T, chromosome 2 at 37,563,464 bp
  • G to A, chromosome 2 at 39,052,098 bp
  • A to G, chromosome 2 at 66,247,361 bp
  • A to T, chromosome 2 at 143,988,935 bp
  • G to T, chromosome 2 at 170,406,427 bp
  • T to C, chromosome 3 at 16,189,517 bp
  • T to C, chromosome 3 at 67,479,344 bp
  • A to G, chromosome 3 at 115,712,298 bp
  • C to T, chromosome 3 at 122,426,694 bp
  • T to C, chromosome 3 at 145,151,015 bp
  • G to A, chromosome 4 at 34,809,865 bp
  • T to C, chromosome 4 at 46,546,809 bp
  • A to T, chromosome 4 at 129,518,095 bp
  • A to T, chromosome 4 at 134,093,888 bp
  • G to T, chromosome 4 at 143,698,194 bp
  • C to T, chromosome 4 at 146,537,643 bp
  • T to C, chromosome 5 at 8,686,132 bp
  • T to C, chromosome 5 at 21,543,787 bp
  • G to T, chromosome 5 at 64,349,752 bp
  • A to T, chromosome 5 at 110,649,673 bp
  • A to T, chromosome 5 at 139,771,379 bp
  • C to CTCT, chromosome 6 at 4,756,453 bp
  • T to C, chromosome 6 at 18,448,414 bp
  • T to C, chromosome 6 at 41,394,773 bp
  • T to A, chromosome 6 at 88,103,396 bp
  • T to C, chromosome 6 at 99,640,638 bp
  • T to C, chromosome 6 at 113,266,302 bp
  • A to T, chromosome 7 at 24,105,145 bp
  • A to G, chromosome 7 at 26,201,092 bp
  • A to T, chromosome 7 at 46,099,857 bp
  • G to A, chromosome 7 at 75,730,465 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • T to A, chromosome 7 at 126,777,841 bp
  • A to G, chromosome 8 at 33,581,655 bp
  • T to C, chromosome 8 at 47,537,300 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 102,731,654 bp
  • T to C, chromosome 10 at 5,841,501 bp
  • A to G, chromosome 11 at 46,616,176 bp
  • TCACACTCGGCACA to TCACA, chromosome 11 at 50,815,240 bp
  • G to T, chromosome 11 at 59,450,336 bp
  • T to A, chromosome 11 at 87,860,716 bp
  • T to A, chromosome 11 at 94,778,958 bp
  • T to C, chromosome 11 at 98,005,289 bp
  • C to T, chromosome 11 at 103,636,854 bp
  • T to A, chromosome 12 at 72,495,692 bp
  • C to T, chromosome 12 at 74,976,683 bp
  • G to A, chromosome 12 at 98,682,532 bp
  • T to C, chromosome 12 at 115,243,226 bp
  • G to T, chromosome 13 at 23,704,399 bp
  • C to T, chromosome 13 at 24,803,399 bp
  • A to T, chromosome 13 at 37,025,771 bp
  • T to C, chromosome 14 at 49,929,165 bp
  • T to A, chromosome 14 at 51,592,112 bp
  • A to T, chromosome 14 at 65,401,858 bp
  • G to A, chromosome 15 at 37,979,832 bp
  • T to A, chromosome 15 at 94,322,844 bp
  • C to A, chromosome 15 at 101,011,036 bp
  • A to C, chromosome 15 at 102,117,706 bp
  • G to A, chromosome 16 at 4,613,464 bp
  • C to A, chromosome 16 at 18,151,535 bp
  • A to T, chromosome 16 at 25,889,240 bp
  • A to G, chromosome 16 at 33,799,016 bp
  • T to C, chromosome 16 at 64,479,489 bp
  • G to A, chromosome 16 at 97,545,612 bp
  • T to A, chromosome 17 at 19,794,214 bp
  • A to G, chromosome 17 at 22,573,102 bp
  • A to G, chromosome 18 at 42,395,186 bp
  • A to T, chromosome 19 at 33,514,242 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7816 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045870-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.