Strain Name:
C57BL/6J-MtgxR7832Btlr/Mmmh
Stock Number:
045886-MU
Citation ID:
RRID:MMRRC_045886-MU
Other Names:
R7832 (G1)
Major Collection:

Strain Information

Stx8
Name: syntaxin 8
Synonyms: 0610007H08Rik, 4930571E13Rik, 1110002H11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 55943
Homologene: 37973
Sema3c
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms: Semae, 1110036B02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20348
Homologene: 36201
H2-D1
Name: histocompatibility 2, D region locus 1
Synonyms: H-2D
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14964
Homologene: 128352
Efr3a
Name: EFR3 homolog A
Synonyms: A130089M23Rik, C920006C10Rik, D030063F01Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76740
Homologene: 44222
Fmn2
Name: formin 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54418
Homologene: 137334
Rtn4
Name: reticulon 4
Synonyms: 1110020G17Rik, NgA, C130026I10Rik, Nogo-A, Nogo-B, NOGO
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Ppp2r5d
Name: protein phosphatase 2, regulatory subunit B', delta
Synonyms: TEG-271, Tex271, B'delta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21770
VEGA: 17
HGNC: HGNC:9312
Homologene: 37661
Banp
Name: BTG3 associated nuclear protein
Synonyms: SMAR1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 53325
Homologene: 9635
Ergic1
Name: endoplasmic reticulum-golgi intermediate compartment 1
Synonyms: 1200007D18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67458
Homologene: 41667
Map2k2
Name: mitogen-activated protein kinase kinase 2
Synonyms: MAP kinase/Erk kinase, MEK2, Prkmk2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 26396
HGNC: HGNC:6842
Homologene: 48591
Emsy
Name: EMSY, BRCA2-interacting transcriptional repressor
Synonyms: 2210018M11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233545
Homologene: 32465
Lfng
Name: LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonyms: lunatic fringe
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16848
HGNC: HGNC:6560
Homologene: 22475
Cramp1
Name: cramped chromatin regulator 1
Synonyms: Cramp1l, 5830477H08Rik, Tce4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57354
VEGA: 17
Homologene: 35373
Tfrc
Name: transferrin receptor
Synonyms: TfR1, Mtvr1, Mtvr-1, p90, Trfr, E430033M20Rik, 2610028K12Rik, CD71
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22042
Homologene: 2429
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Smc6
Name: structural maintenance of chromosomes 6
Synonyms: 2810489L22Rik, 3830418C19Rik, Smc6l1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67241
VEGA: 12
Homologene: 41575
Pcdh20
Name: protocadherin 20
Synonyms: C630015B17Rik, PCDH13
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219257
Homologene: 11277
Larp7
Name: La ribonucleoprotein 7, transcriptional regulator
Synonyms: D3Wsu161e, C330027G06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 28036
Homologene: 88843
Cdc23
Name: CDC23 cell division cycle 23
Synonyms: D18Ertd243e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 52563
HGNC: HGNC:1724
Homologene: 3426
Rbm45
Name: RNA binding motif protein 45
Synonyms: Drb1, Drbp1, G430095G15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241490
Homologene: 15560
Susd4
Name: sushi domain containing 4
Synonyms: E430021N18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 96935
Homologene: 23062
Scn4a
Name: sodium channel, voltage-gated, type IV, alpha
Synonyms: SkM1, mH2, Nav1.4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 110880
Homologene: 283
Slfn4
Name: schlafen 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20558
Homologene: 133236
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Or9s23
Name: olfactory receptor family 9 subfamily S member 23
Synonyms: GA_x6K02T2R7CC-81180849-81179878, Olfr1413, MOR208-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 259039
Homologene: 128165
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 1110021D17Rik, Polydom, D430029O09Rik, 4833413O10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Liph
Name: lipase, member H
Synonyms: mPA-PLA1, PLA1B, Lpdlr, LPDLR, C130037N08Rik, D16Wsu119e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239759
VEGA: 16
Homologene: 71802
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Itgb4
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192897
HGNC: HGNC:6158
Homologene: 179
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Il23r
Name: interleukin 23 receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209590
Homologene: 16930
Ikzf3
Name: IKAROS family zinc finger 3
Synonyms: 5830411O07Rik, Aiolos, Zfpn1a3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22780
Homologene: 8269
Wdr41
Name: WD repeat domain 41
Synonyms: B830029I03Rik, MSTP048
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218460
Homologene: 23087
Dcaf10
Name: DDB1 and CUL4 associated factor 10
Synonyms: Wdr32
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242418
Homologene: 32581
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Arhgef10l
Name: Rho guanine nucleotide exchange factor 10-like
Synonyms: 2810441C07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72754
Homologene: 10017
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: mSlo1, Slo, 5730414M22Rik, BK channel alpha subunit, BKCa, MaxiK, Slo1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Atp6v0d2
Name: ATPase, H+ transporting, lysosomal V0 subunit D2
Synonyms: 1620401A02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242341
Homologene: 72090
Fam76a
Name: family with sequence similarity 76, member A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230789
Homologene: 27071
Irf5
Name: interferon regulatory factor 5
Synonyms: mirf5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27056
HGNC: HGNC:6120
Homologene: 8088
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Or5b101
Name: olfactory receptor family 5 subfamily B member 101
Synonyms: Olfr1453, GA_x6K02T2RE5P-3357666-3356743, MOR202-6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258695
HGNC: HGNC:8324
Homologene: 120159
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: Pla2g1br, PLA2-I receptor, M-type receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Slc6a19
Name: solute carrier family 6 (neurotransmitter transporter), member 19
Synonyms: 4632401C08Rik, B0AT1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74338
Homologene: 52819
D630003M21Rik
Name: RIKEN cDNA D630003M21 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228846
Homologene: 18598
Dnai1
Name: dynein axonemal intermediate chain 1
Synonyms: 1110066F04Rik, b2b1526Clo, Dnaic1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68922
HGNC: HGNC:2954
Homologene: 8122
Armc2
Name: armadillo repeat containing 2
Synonyms: 2610018I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213402
Homologene: 41848
Mmrn1
Name: multimerin 1
Synonyms: 4921530G03Rik, Emilin4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70945
HGNC: HGNC:7178
Homologene: 49134
Akr1c20
Name: aldo-keto reductase family 1, member C20
Synonyms: 2610528B18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 116852
Zfp202
Name: zinc finger protein 202
Synonyms: C130037E22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80902
Homologene: 68317
Gabbr2
Name: gamma-aminobutyric acid type B receptor subunit 2
Synonyms: Gababr2, GB2, LOC242425, Gpr51
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242425
HGNC: HGNC:4507
Homologene: 55902
Crygn
Name: crystallin, gamma N
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 214301
Homologene: 16986
Fah
Name: fumarylacetoacetate hydrolase
Synonyms: swst
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14085
HGNC: HGNC:3579
Homologene: 110
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Vmn1r201
Name: vomeronasal 1 receptor 201
Synonyms: V1ri4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171255
Homologene: 110880
Itga2b
Name: integrin alpha 2b
Synonyms: platelet glycoprotein IIb, CD41, GP IIb, alphaIIb, GpIIb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16399
HGNC: HGNC:6138
Homologene: 37304
Nod2
Name: nucleotide-binding oligomerization domain containing 2
Synonyms: Nlrc2, F830032C23Rik, Card15
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 257632
HGNC: HGNC:5331
Homologene: 11156
Vmn1r230
Name: vomeronasal 1 receptor 230
Synonyms: V1re8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171231
Homologene: 136306
Vmn2r20
Name: vomeronasal 2, receptor 20
Synonyms: EG667180
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 667180
Homologene: 84037
Ccdc188
Name: coiled-coil domain containing 188
Synonyms: Gm7873
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 102638083
VEGA: 16
Homologene: 90442
Insyn2b
Name: inhibitory synaptic factor family member 2B
Synonyms: Gm6041, Fam196b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 574403
VEGA: 11
Homologene: 107175
Ano7
Name: anoctamin 7
Synonyms: IPCA-5, NGEP-L, Tmem16g, NGEP, Pcanap5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 404545
Homologene: 45787
Ttll3
Name: tubulin tyrosine ligase-like family, member 3
Synonyms: 4833441J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101100
Homologene: 134361
Vmn2r81
Name: vomeronasal 2, receptor 81
Synonyms: EC1-VR2, V2rf2, pheromone recepter
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216144
Homologene: 83483
Cnot6l
Name: CCR4-NOT transcription complex, subunit 6-like
Synonyms: 4932442K20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231464
Homologene: 100830
Pom121l2
Name: POM121 transmembrane nucleoporin like 2
Synonyms: LOC195236
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195236
Homologene: 123536
Spatc1l
Name: spermatogenesis and centriole associated 1 like
Synonyms: 1700027D21Rik, 1700022B01Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76573
HGNC: HGNC:1298
Homologene: 75292
Car8
Name: carbonic anhydrase 8
Synonyms: wdl, CA-RP VIII, Carp, Cals1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12319
HGNC: HGNC:1382
Homologene: 20861
Or51ag1
Name: olfactory receptor family 51 subfamily AG member 1
Synonyms: Olfr610, MOR9-2, GA_x6K02T2PBJ9-6221839-6220892
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259085
Homologene: 17495
Tbx20
Name: T-box 20
Synonyms: Tbx12, 9430010M06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57246
VEGA: 9
Homologene: 32476
Sult2a8
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 8
Synonyms: mL-STL, 2810007J24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76971
Dmrtb1
Name: DMRT-like family B with proline-rich C-terminal, 1
Synonyms: Dmrt6, Prp13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56296
Homologene: 13207
Slc35a5
Name: solute carrier family 35, member A5
Synonyms: D730043G07Rik, D16Ertd450e, 1010001J06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74102
Homologene: 9930
Abhd11
Name: abhydrolase domain containing 11
Synonyms: A630008N09Rik, 1110054D16Rik, Wbscr21
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68758
Homologene: 5961
Fbxl22
Name: F-box and leucine-rich repeat protein 22
Synonyms: 1110004B15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74165
VEGA: 9
Homologene: 35275
Six4
Name: sine oculis-related homeobox 4
Synonyms: AREC3, TrexBF
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20474
Homologene: 69089
Gm7489
Name: predicted gene 7489
Type: Gene
Species: Mouse
Chromosome: 15
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 20,502,999 bp
  • T to C, chromosome 1 at 92,573,497 bp
  • A to G, chromosome 1 at 93,394,473 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • G to A, chromosome 1 at 182,858,505 bp
  • T to A, chromosome 2 at 60,504,192 bp
  • G to T, chromosome 2 at 76,376,453 bp
  • T to A, chromosome 2 at 158,217,668 bp
  • A to T, chromosome 3 at 39,001,204 bp
  • A to T, chromosome 3 at 127,544,267 bp
  • T to A, chromosome 4 at 8,238,860 bp
  • T to A, chromosome 4 at 19,922,400 bp
  • A to G, chromosome 4 at 41,605,823 bp
  • T to G, chromosome 4 at 45,348,196 bp
  • A to T, chromosome 4 at 46,734,096 bp
  • T to C, chromosome 4 at 53,734,859 bp
  • G to A, chromosome 4 at 58,054,539 bp
  • C to T, chromosome 4 at 107,683,982 bp
  • G to A, chromosome 4 at 132,902,031 bp
  • G to A, chromosome 4 at 140,578,305 bp
  • G to A, chromosome 5 at 17,694,847 bp
  • T to C, chromosome 5 at 24,756,074 bp
  • T to C, chromosome 5 at 96,094,225 bp
  • T to G, chromosome 5 at 110,317,797 bp
  • G to A, chromosome 5 at 135,009,800 bp
  • G to A, chromosome 5 at 140,612,833 bp
  • A to G, chromosome 6 at 29,535,462 bp
  • T to A, chromosome 6 at 60,987,060 bp
  • T to C, chromosome 6 at 67,423,862 bp
  • CAAAGTAA to CAAAGTAAAGTAA, chromosome 6 at 113,399,157 bp
  • A to G, chromosome 6 at 123,385,923 bp
  • A to T, chromosome 7 at 14,413,671 bp
  • A to G, chromosome 7 at 84,595,478 bp
  • G to A, chromosome 7 at 98,639,853 bp
  • A to C, chromosome 7 at 103,506,379 bp
  • A to G, chromosome 8 at 88,660,797 bp
  • A to G, chromosome 8 at 112,757,481 bp
  • A to G, chromosome 8 at 122,020,552 bp
  • A to T, chromosome 9 at 24,773,812 bp
  • A to G, chromosome 9 at 40,210,462 bp
  • G to T, chromosome 9 at 66,511,717 bp
  • A to C, chromosome 10 at 41,966,796 bp
  • A to T, chromosome 10 at 52,144,861 bp
  • A to G, chromosome 10 at 76,562,390 bp
  • A to T, chromosome 10 at 79,293,830 bp
  • A to T, chromosome 10 at 81,118,206 bp
  • T to A, chromosome 11 at 29,741,048 bp
  • A to G, chromosome 11 at 34,403,034 bp
  • T to A, chromosome 11 at 68,109,280 bp
  • A to G, chromosome 11 at 83,186,593 bp
  • T to A, chromosome 11 at 98,518,699 bp
  • A to T, chromosome 11 at 102,457,282 bp
  • A to G, chromosome 11 at 106,322,015 bp
  • A to G, chromosome 11 at 116,000,261 bp
  • T to C, chromosome 12 at 11,317,843 bp
  • T to C, chromosome 12 at 73,112,634 bp
  • C to T, chromosome 13 at 4,512,672 bp
  • C to T, chromosome 13 at 21,983,878 bp
  • T to C, chromosome 13 at 22,475,368 bp
  • A to G, chromosome 13 at 73,693,063 bp
  • A to T, chromosome 13 at 95,015,193 bp
  • G to T, chromosome 14 at 23,390,923 bp
  • G to T, chromosome 14 at 88,469,707 bp
  • A to G, chromosome 15 at 53,886,006 bp
  • G to A, chromosome 15 at 65,829,830 bp
  • C to T, chromosome 16 at 18,218,675 bp
  • T to C, chromosome 16 at 21,962,236 bp
  • A to G, chromosome 16 at 32,619,167 bp
  • T to A, chromosome 16 at 45,144,207 bp
  • A to G, chromosome 17 at 20,846,671 bp
  • A to T, chromosome 17 at 24,983,222 bp
  • A to G, chromosome 17 at 26,634,475 bp
  • A to T, chromosome 17 at 30,973,692 bp
  • A to G, chromosome 17 at 35,263,872 bp
  • A to T, chromosome 17 at 46,684,546 bp
  • G to C, chromosome 18 at 10,542,056 bp
  • A to T, chromosome 18 at 34,647,019 bp
  • T to A, chromosome 19 at 13,027,996 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7832 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045886-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.