Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7832Btlr/Mmmh
Stock Number:
045886-MU
Citation ID:
RRID:MMRRC_045886-MU
Other Names:
R7832 (G1)
Major Collection:

Strain Information

Stx8
Name: syntaxin 8
Synonyms: 1110002H11Rik, 0610007H08Rik, 4930571E13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 55943
Homologene: 37973
Sema3c
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms: Semae, 1110036B02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20348
Homologene: 36201
Efr3a
Name: EFR3 homolog A
Synonyms: A130089M23Rik, D030063F01Rik, C920006C10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76740
Homologene: 44222
Rtn4
Name: reticulon 4
Synonyms: 1110020G17Rik, C130026I10Rik, NOGO, NgA, Nogo-B, Nogo-A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Ppp2r5d
Name: protein phosphatase 2, regulatory subunit B', delta
Synonyms: TEG-271, Tex271, B'delta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21770
VEGA: 17
HGNC: HGNC:9312
Homologene: 37661
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 20,502,999 bp
  • T to C, chromosome 1 at 92,573,497 bp
  • A to G, chromosome 1 at 93,394,473 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • G to A, chromosome 1 at 182,858,505 bp
  • T to A, chromosome 2 at 60,504,192 bp
  • G to T, chromosome 2 at 76,376,453 bp
  • T to A, chromosome 2 at 158,217,668 bp
  • A to T, chromosome 3 at 39,001,204 bp
  • A to T, chromosome 3 at 127,544,267 bp
  • T to A, chromosome 4 at 8,238,860 bp
  • T to A, chromosome 4 at 19,922,400 bp
  • A to G, chromosome 4 at 41,605,823 bp
  • T to G, chromosome 4 at 45,348,196 bp
  • A to T, chromosome 4 at 46,734,096 bp
  • T to C, chromosome 4 at 53,734,859 bp
  • G to A, chromosome 4 at 58,054,539 bp
  • C to T, chromosome 4 at 107,683,982 bp
  • G to A, chromosome 4 at 132,902,031 bp
  • G to A, chromosome 4 at 140,578,305 bp
  • G to A, chromosome 5 at 17,694,847 bp
  • T to C, chromosome 5 at 24,756,074 bp
  • T to C, chromosome 5 at 96,094,225 bp
  • T to G, chromosome 5 at 110,317,797 bp
  • G to A, chromosome 5 at 135,009,800 bp
  • G to A, chromosome 5 at 140,612,833 bp
  • A to G, chromosome 6 at 29,535,462 bp
  • T to A, chromosome 6 at 60,987,060 bp
  • T to C, chromosome 6 at 67,423,862 bp
  • CAAAGTAA to CAAAGTAAAGTAA, chromosome 6 at 113,399,157 bp
  • A to G, chromosome 6 at 123,385,923 bp
  • A to T, chromosome 7 at 14,413,671 bp
  • A to G, chromosome 7 at 84,595,478 bp
  • G to A, chromosome 7 at 98,639,853 bp
  • A to C, chromosome 7 at 103,506,379 bp
  • A to G, chromosome 8 at 88,660,797 bp
  • A to G, chromosome 8 at 112,757,481 bp
  • A to G, chromosome 8 at 122,020,552 bp
  • A to T, chromosome 9 at 24,773,812 bp
  • A to G, chromosome 9 at 40,210,462 bp
  • G to T, chromosome 9 at 66,511,717 bp
  • A to C, chromosome 10 at 41,966,796 bp
  • A to T, chromosome 10 at 52,144,861 bp
  • A to G, chromosome 10 at 76,562,390 bp
  • A to T, chromosome 10 at 79,293,830 bp
  • A to T, chromosome 10 at 81,118,206 bp
  • T to A, chromosome 11 at 29,741,048 bp
  • A to G, chromosome 11 at 34,403,034 bp
  • T to A, chromosome 11 at 68,109,280 bp
  • A to G, chromosome 11 at 83,186,593 bp
  • T to A, chromosome 11 at 98,518,699 bp
  • A to T, chromosome 11 at 102,457,282 bp
  • A to G, chromosome 11 at 106,322,015 bp
  • A to G, chromosome 11 at 116,000,261 bp
  • T to C, chromosome 12 at 11,317,843 bp
  • T to C, chromosome 12 at 73,112,634 bp
  • C to T, chromosome 13 at 4,512,672 bp
  • C to T, chromosome 13 at 21,983,878 bp
  • T to C, chromosome 13 at 22,475,368 bp
  • A to G, chromosome 13 at 73,693,063 bp
  • A to T, chromosome 13 at 95,015,193 bp
  • G to T, chromosome 14 at 23,390,923 bp
  • G to T, chromosome 14 at 88,469,707 bp
  • A to G, chromosome 15 at 53,886,006 bp
  • G to A, chromosome 15 at 65,829,830 bp
  • C to T, chromosome 16 at 18,218,675 bp
  • T to C, chromosome 16 at 21,962,236 bp
  • A to G, chromosome 16 at 32,619,167 bp
  • T to A, chromosome 16 at 45,144,207 bp
  • A to G, chromosome 17 at 20,846,671 bp
  • A to T, chromosome 17 at 24,983,222 bp
  • A to G, chromosome 17 at 26,634,475 bp
  • A to T, chromosome 17 at 30,973,692 bp
  • A to G, chromosome 17 at 35,263,872 bp
  • A to T, chromosome 17 at 46,684,546 bp
  • G to C, chromosome 18 at 10,542,056 bp
  • A to T, chromosome 18 at 34,647,019 bp
  • T to A, chromosome 19 at 13,027,996 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7832 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045886-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.