Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7835Btlr/Mmmh
Stock Number:
045889-MU
Citation ID:
RRID:MMRRC_045889-MU
Other Names:
R7835 (G1)
Major Collection:

Strain Information

Ppcdc
Name: phosphopantothenoylcysteine decarboxylase
Synonyms: 8430432M10Rik, 1810057I13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66812
VEGA: 9
Homologene: 11049
Rps23rg1
Name: ribosomal protein S23, retrogene 1
Synonyms: C330021F23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546049
Homologene: 134322
Chst5
Name: carbohydrate sulfotransferase 5
Synonyms: I-GlcNAc6ST, GST-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56773
Homologene: 56927
Depdc7
Name: DEP domain containing 7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211896
Homologene: 16386
Wee1
Name: WEE 1 homolog 1 (S. pombe)
Synonyms: Wee1A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22390
Homologene: 31152
Znfx1
Name: zinc finger, NFX1-type containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98999
Homologene: 10877
Kif13b
Name: kinesin family member 13B
Synonyms: GAKIN, N-3 kinesin, C130021D12Rik, 5330429L19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16554
VEGA: 14
Homologene: 9073
Taf4
Name: TATA-box binding protein associated factor 4
Synonyms: Taf2c1, TAFII135, TAFII130, Taf4a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228980
Homologene: 55723
Tasor
Name: transcription activation suppressor
Synonyms: 4933409E02Rik, D14Abb1e, MommeD6, Fam208a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Polr1a
Name: polymerase (RNA) I polypeptide A
Synonyms: mRPA1, RPA194, 194kDa, 3010014K16Rik, Rpo1-4, 2900087K15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20019
Homologene: 7033
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Slc38a10
Name: solute carrier family 38, member 10
Synonyms: 1810073N04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72055
Homologene: 41556
Nup85
Name: nucleoporin 85
Synonyms: frount, Pcnt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 445007
HGNC: HGNC:8734
Homologene: 11755
Rps26
Name: ribosomal protein S26
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27370
VEGA: 10
Homologene: 37420
Zfp981
Name: zinc finger protein 981
Synonyms: Gm13247
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041433
Homologene: 133076
Zfp451
Name: zinc finger protein 451
Synonyms: Kiaa0576-hp, 4933435G09Rik, 4930515K21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98403
Homologene: 9188
Runx2
Name: runt related transcription factor 2
Synonyms: AML3, polyomavirus enhancer binding factor 2 (PEBP2), SL3-3 enhancer factor 1, PEBP2 alpha A, PEBP2aA, Osf2, Cbfa1, Pebpa2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12393
Homologene: 68389
Mzt1
Name: mitotic spindle organizing protein 1
Synonyms: 2410129H14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76789
VEGA: 14
Homologene: 45495
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Wdr89
Name: WD repeat domain 89
Synonyms: 2600001A11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72338
Homologene: 43791
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Kdm5d
Name: lysine demethylase 5D
Synonyms: Smcy, Jarid1d, HY
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 20592
Homologene: 55838
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Lrp4
Name: low density lipoprotein receptor-related protein 4
Synonyms: 6430526J12Rik, Megf7, mdig
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228357
HGNC: HGNC:6696
Homologene: 17964
Adamts3
Name: ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms: 6330442E02Rik, 1100001H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Ihh
Name: Indian hedgehog
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16147
HGNC: HGNC:5956
Homologene: 22586
Trim65
Name: tripartite motif-containing 65
Synonyms: 4732463G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338364
Homologene: 27844
Olfm5
Name: olfactomedin 5
Synonyms: E030002O03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244180
Homologene: 18253
Sh3rf2
Name: SH3 domain containing ring finger 2
Synonyms: RNF158, 9130023G24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269016
Homologene: 17618
Adap2
Name: ArfGAP with dual PH domains 2
Synonyms: Centa2, centaurin alpha 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216991
Homologene: 10179
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626596
Homologene: 75047
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Acan
Name: aggrecan
Synonyms: Cspg1, Agc1, b2b183Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11595
HGNC: HGNC:319
Homologene: 137204
Accsl
Name: 1-aminocyclopropane-1-carboxylate synthase (inactive)-like
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381411
Homologene: 86007
Or7g16
Name: olfactory receptor family 7 subfamily G member 16
Synonyms: GA_x6K02T2PVTD-12559294-12558356, MOR149-1, Olfr828
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258598
HGNC: HGNC:8466
Homologene: 133690
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Serinc2
Name: serine incorporator 2
Synonyms: FKSG84, TDE2, 2310004K20Rik, Tde2l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230779
Homologene: 27797
Cers3
Name: ceramide synthase 3
Synonyms: T3L, related to TRH3, LOC233330, 4930550L11Rik, CerS3, Lass3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545975
Homologene: 18719
Mrpl19
Name: mitochondrial ribosomal protein L19
Synonyms: MRP-L15, D6Ertd157e, Rpml15, RLX1, 9030416F12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56284
Homologene: 8851
Tmem102
Name: transmembrane protein 102
Synonyms: Tmem102-ps, Cbap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380705
Homologene: 86820
Prss21
Name: serine protease 21
Synonyms: testisin, 1700023E12Rik, mT4, TESP5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57256
HGNC: HGNC:9485
Homologene: 137342
Ccne1
Name: cyclin E1
Synonyms: cyclin E, CycE1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12447
HGNC: HGNC:1589
Homologene: 14452
Lrrc61
Name: leucine rich repeat containing 61
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243371
Homologene: 41538
Vmn1r57
Name: vomeronasal 1 receptor 57
Synonyms: Gm7519
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665150
Homologene: 41799
Vmn1r160
Name: vomeronasal 1 receptor 160
Synonyms: Gm6178
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620758
Homologene: 104166
Lcn8
Name: lipocalin 8
Synonyms: EP17, mEP17, 9230106L18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78076
Homologene: 69532
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 33,772,979 bp
  • A to G, chromosome 1 at 74,946,366 bp
  • C to A, chromosome 2 at 25,655,296 bp
  • T to C, chromosome 2 at 52,150,577 bp
  • T to C, chromosome 2 at 91,495,042 bp
  • T to A, chromosome 2 at 93,865,984 bp
  • A to G, chromosome 2 at 104,728,185 bp
  • A to G, chromosome 2 at 167,039,827 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • G to T, chromosome 4 at 100,974,153 bp
  • A to C, chromosome 4 at 130,275,487 bp
  • A to T, chromosome 4 at 146,537,876 bp
  • A to T, chromosome 5 at 89,700,440 bp
  • G to A, chromosome 5 at 124,777,234 bp
  • A to T, chromosome 6 at 48,568,572 bp
  • T to C, chromosome 6 at 71,915,142 bp
  • G to A, chromosome 6 at 81,962,126 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to T, chromosome 7 at 5,221,139 bp
  • T to A, chromosome 7 at 22,871,954 bp
  • T to G, chromosome 7 at 28,117,207 bp
  • G to T, chromosome 7 at 38,102,845 bp
  • C to T, chromosome 7 at 66,773,639 bp
  • T to A, chromosome 7 at 79,099,875 bp
  • A to T, chromosome 7 at 104,154,445 bp
  • C to A, chromosome 7 at 110,130,878 bp
  • G to C, chromosome 7 at 141,809,303 bp
  • A to G, chromosome 8 at 3,580,452 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to T, chromosome 8 at 111,890,602 bp
  • T to A, chromosome 9 at 18,815,809 bp
  • T to A, chromosome 9 at 52,065,788 bp
  • A to G, chromosome 9 at 57,420,276 bp
  • A to G, chromosome 10 at 69,987,727 bp
  • G to A, chromosome 10 at 86,872,619 bp
  • C to T, chromosome 10 at 128,626,126 bp
  • A to G, chromosome 11 at 69,804,345 bp
  • T to A, chromosome 11 at 80,160,231 bp
  • A to G, chromosome 11 at 115,570,071 bp
  • A to G, chromosome 11 at 116,130,929 bp
  • A to G, chromosome 11 at 120,116,996 bp
  • C to A, chromosome 12 at 75,632,899 bp
  • G to T, chromosome 13 at 100,316,004 bp
  • G to T, chromosome 14 at 27,476,643 bp
  • T to A, chromosome 14 at 64,767,452 bp
  • T to C, chromosome 14 at 99,046,003 bp
  • A to G, chromosome 15 at 36,081,911 bp
  • A to T, chromosome 17 at 23,869,451 bp
  • A to T, chromosome 17 at 44,608,236 bp
  • C to A, chromosome 18 at 42,111,170 bp
  • A to T, chromosome 18 at 63,082,945 bp
  • T to C, chromosome Y at 900,558 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7835 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045889-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.