Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7835Btlr/Mmmh
Stock Number:
045889-MU
Citation ID:
RRID:MMRRC_045889-MU
Other Names:
R7835 (G1)
Major Collection:

Strain Information

Ppcdc
Name: phosphopantothenoylcysteine decarboxylase
Synonyms: 8430432M10Rik, 1810057I13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66812
VEGA: 9
Homologene: 11049
Rps23rg1
Name: ribosomal protein S23, retrogene 1
Synonyms: C330021F23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546049
Homologene: 134322
Chst5
Name: carbohydrate sulfotransferase 5
Synonyms: I-GlcNAc6ST, GST-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56773
Homologene: 56927
Depdc7
Name: DEP domain containing 7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211896
Homologene: 16386
Wee1
Name: WEE 1 homolog 1 (S. pombe)
Synonyms: Wee1A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22390
Homologene: 31152
Znfx1
Name: zinc finger, NFX1-type containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98999
Homologene: 10877
Kif13b
Name: kinesin family member 13B
Synonyms: GAKIN, N-3 kinesin, C130021D12Rik, 5330429L19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16554
VEGA: 14
Homologene: 9073
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 33,772,979 bp
  • A to G, chromosome 1 at 74,946,366 bp
  • C to A, chromosome 2 at 25,655,296 bp
  • T to C, chromosome 2 at 52,150,577 bp
  • T to C, chromosome 2 at 91,495,042 bp
  • T to A, chromosome 2 at 93,865,984 bp
  • A to G, chromosome 2 at 104,728,185 bp
  • A to G, chromosome 2 at 167,039,827 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • G to T, chromosome 4 at 100,974,153 bp
  • A to C, chromosome 4 at 130,275,487 bp
  • A to T, chromosome 4 at 146,537,876 bp
  • A to T, chromosome 5 at 89,700,440 bp
  • G to A, chromosome 5 at 124,777,234 bp
  • A to T, chromosome 6 at 48,568,572 bp
  • T to C, chromosome 6 at 71,915,142 bp
  • G to A, chromosome 6 at 81,962,126 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to T, chromosome 7 at 5,221,139 bp
  • T to A, chromosome 7 at 22,871,954 bp
  • T to G, chromosome 7 at 28,117,207 bp
  • G to T, chromosome 7 at 38,102,845 bp
  • C to T, chromosome 7 at 66,773,639 bp
  • T to A, chromosome 7 at 79,099,875 bp
  • A to T, chromosome 7 at 104,154,445 bp
  • C to A, chromosome 7 at 110,130,878 bp
  • G to C, chromosome 7 at 141,809,303 bp
  • A to G, chromosome 8 at 3,580,452 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to T, chromosome 8 at 111,890,602 bp
  • T to A, chromosome 9 at 18,815,809 bp
  • T to A, chromosome 9 at 52,065,788 bp
  • A to G, chromosome 9 at 57,420,276 bp
  • A to G, chromosome 10 at 69,987,727 bp
  • G to A, chromosome 10 at 86,872,619 bp
  • C to T, chromosome 10 at 128,626,126 bp
  • A to G, chromosome 11 at 69,804,345 bp
  • T to A, chromosome 11 at 80,160,231 bp
  • A to G, chromosome 11 at 115,570,071 bp
  • A to G, chromosome 11 at 116,130,929 bp
  • A to G, chromosome 11 at 120,116,996 bp
  • C to A, chromosome 12 at 75,632,899 bp
  • G to T, chromosome 13 at 100,316,004 bp
  • G to T, chromosome 14 at 27,476,643 bp
  • T to A, chromosome 14 at 64,767,452 bp
  • T to C, chromosome 14 at 99,046,003 bp
  • A to G, chromosome 15 at 36,081,911 bp
  • A to T, chromosome 17 at 23,869,451 bp
  • A to T, chromosome 17 at 44,608,236 bp
  • C to A, chromosome 18 at 42,111,170 bp
  • A to T, chromosome 18 at 63,082,945 bp
  • T to C, chromosome Y at 900,558 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7835 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045889-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.