Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7840Btlr/Mmmh
Stock Number:
045894-MU
Citation ID:
RRID:MMRRC_045894-MU
Other Names:
R7840 (G1)
Major Collection:

Strain Information

Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Tcf3
Name: transcription factor 3
Synonyms: ALF2, E2A, E47, E12, Pan2, Pan1, A1, Tcfe2a, bHLHb21
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21423
Homologene: 2408
Rexo1
Name: REX1, RNA exonuclease 1
Synonyms: 1700021P10Rik, 2610511M11Rik, Tceb3bp1, Rex1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66932
Homologene: 41391
Anln
Name: anillin, actin binding protein
Synonyms: 1110037A17Rik, Scraps, 2900037I21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68743
VEGA: 9
Homologene: 41281
Snrnp70
Name: small nuclear ribonucleoprotein 70 (U1)
Synonyms: Rnulp70, U1-70, 2700022N21Rik, 3200002N22Rik, Srnp70, Snrp70
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20637
Homologene: 20672
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 75,476,627 bp
  • A to G, chromosome 1 at 131,020,068 bp
  • A to T, chromosome 1 at 178,322,561 bp
  • G to T, chromosome 2 at 58,774,115 bp
  • C to T, chromosome 2 at 69,464,784 bp
  • A to G, chromosome 2 at 86,423,239 bp
  • A to G, chromosome 2 at 132,750,590 bp
  • A to T, chromosome 2 at 150,966,096 bp
  • T to C, chromosome 2 at 165,012,896 bp
  • A to T, chromosome 3 at 90,122,729 bp
  • A to G, chromosome 3 at 96,155,373 bp
  • A to T, chromosome 4 at 45,900,461 bp
  • G to T, chromosome 4 at 111,982,226 bp
  • A to T, chromosome 4 at 145,103,676 bp
  • A to C, chromosome 5 at 71,640,913 bp
  • T to C, chromosome 5 at 117,555,264 bp
  • A to G, chromosome 6 at 28,430,176 bp
  • T to C, chromosome 6 at 40,493,856 bp
  • T to A, chromosome 6 at 40,885,444 bp
  • T to C, chromosome 7 at 5,411,243 bp
  • T to A, chromosome 7 at 45,376,790 bp
  • T to G, chromosome 7 at 51,587,732 bp
  • T to C, chromosome 7 at 100,033,656 bp
  • A to G, chromosome 7 at 120,475,466 bp
  • T to C, chromosome 7 at 128,694,802 bp
  • T to A, chromosome 7 at 139,923,816 bp
  • ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG to ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG, chromosome 7 at 142,296,596 bp
  • T to C, chromosome 8 at 3,258,415 bp
  • T to C, chromosome 8 at 27,582,723 bp
  • G to A, chromosome 8 at 119,445,034 bp
  • T to C, chromosome 8 at 120,166,633 bp
  • A to T, chromosome 9 at 21,124,967 bp
  • G to T, chromosome 9 at 22,362,723 bp
  • G to A, chromosome 9 at 64,695,427 bp
  • A to G, chromosome 9 at 108,305,787 bp
  • A to T, chromosome 10 at 5,132,078 bp
  • C to G, chromosome 10 at 39,626,455 bp
  • C to T, chromosome 10 at 80,410,467 bp
  • A to G, chromosome 10 at 80,550,738 bp
  • C to T, chromosome 10 at 85,888,050 bp
  • T to C, chromosome 10 at 91,101,755 bp
  • T to C, chromosome 11 at 59,077,950 bp
  • A to T, chromosome 11 at 68,829,980 bp
  • C to A, chromosome 11 at 73,353,759 bp
  • G to A, chromosome 11 at 104,733,713 bp
  • G to A, chromosome 12 at 44,541,075 bp
  • C to T, chromosome 12 at 109,594,155 bp
  • A to C, chromosome 13 at 8,836,875 bp
  • A to T, chromosome 13 at 19,216,521 bp
  • A to T, chromosome 13 at 22,883,153 bp
  • T to C, chromosome 13 at 42,155,352 bp
  • T to C, chromosome 13 at 55,475,509 bp
  • T to C, chromosome 13 at 96,419,798 bp
  • T to C, chromosome 13 at 100,144,409 bp
  • T to A, chromosome 13 at 100,315,471 bp
  • A to G, chromosome 14 at 34,237,566 bp
  • A to G, chromosome 14 at 51,764,072 bp
  • G to A, chromosome 15 at 9,311,817 bp
  • T to C, chromosome 15 at 51,973,142 bp
  • A to C, chromosome 15 at 102,359,098 bp
  • A to G, chromosome 16 at 17,926,274 bp
  • A to G, chromosome 16 at 43,971,544 bp
  • T to A, chromosome 16 at 45,751,364 bp
  • T to C, chromosome 16 at 48,498,784 bp
  • A to T, chromosome 17 at 17,877,372 bp
  • A to T, chromosome 17 at 21,746,150 bp
  • G to T, chromosome 17 at 37,498,977 bp
  • T to C, chromosome 17 at 46,250,864 bp
  • C to A, chromosome 17 at 71,230,274 bp
  • A to T, chromosome 18 at 52,525,122 bp
  • G to A, chromosome 18 at 78,783,424 bp
  • A to T, chromosome 18 at 89,560,058 bp
  • T to C, chromosome 19 at 3,287,752 bp
  • A to T, chromosome 19 at 56,531,252 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7840 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045894-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.