Strain Name:
C57BL/6J-MtgxR7840Btlr/Mmmh
Stock Number:
045894-MU
Citation ID:
RRID:MMRRC_045894-MU
Other Names:
R7840 (G1)
Major Collection:

Strain Information

Nrcam
Name: neuronal cell adhesion molecule
Synonyms: C030017F07Rik, C130076O07Rik, Bravo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: b2b1625.2Clo, Gp330, Megalin, D230004K18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Tcf3
Name: transcription factor 3
Synonyms: Pan1, Tcfe2a, ALF2, E2A, E12, E47, bHLHb21, Pan2, A1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21423
Homologene: 2408
Rexo1
Name: REX1, RNA exonuclease 1
Synonyms: 1700021P10Rik, 2610511M11Rik, Rex1, Tceb3bp1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66932
Homologene: 41391
Anln
Name: anillin, actin binding protein
Synonyms: Scraps, 2900037I21Rik, 1110037A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68743
VEGA: 9
Homologene: 41281
Snrnp70
Name: small nuclear ribonucleoprotein 70 (U1)
Synonyms: U1-70, Srnp70, Rnulp70, Snrp70, 2700022N21Rik, 3200002N22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20637
Homologene: 20672
Lpin2
Name: lipin 2
Synonyms: 2610511G02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64898
Homologene: 8769
Otud7b
Name: OTU domain containing 7B
Synonyms: 2900060B22Rik, 4930463P07Rik, Za20d1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229603
Homologene: 10624
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: SYNE-1, A330049M09Rik, enaptin165, nesprin-1, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Cox20
Name: cytochrome c oxidase assembly protein 20
Synonyms: 2310005N03Rik, Fam36a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66359
Homologene: 11956
Wdr37
Name: WD repeat domain 37
Synonyms: 4933417A01Rik, 3110035P10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 207615
Homologene: 40914
Pwp1
Name: PWP1 homolog, endonuclein
Synonyms: 2610205J09Rik, 2310058A11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103136
Homologene: 5129
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: 2600006O07Rik, mNudel
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83431
Homologene: 32567
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Shld2
Name: shieldin complex subunit 2
Synonyms: Fam35a, 3110001K24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75698
VEGA: 14
Homologene: 56840
Chpf
Name: chondroitin polymerizing factor
Synonyms: D1Bwg1363e, 1700028N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74241
Homologene: 11574
Chrdl2
Name: chordin-like 2
Synonyms: Chl2, 1810022C01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69121
Homologene: 128795
Morc1
Name: microrchidia 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17450
VEGA: 16
HGNC: HGNC:7198
Homologene: 7843
Shld1
Name: shieldin complex subunit 1
Synonyms: 1110034G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73747
Homologene: 51865
Inpp5f
Name: inositol polyphosphate-5-phosphatase F
Synonyms: SAC2, 5830435P03Rik, cI-27
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101490
Homologene: 8962
Abca16
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Ksr2
Name: kinase suppressor of ras 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 333050
Homologene: 45469
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Birc1b, Naip2, Naip-rs6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Ang4
Name: angiogenin, ribonuclease A family, member 4
Synonyms: Rnase5d
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219033
HGNC: HGNC:483
Homologene: 135633
Dbn1
Name: drebrin 1
Synonyms: drebrin A, drebrin E2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56320
HGNC: HGNC:2695
Homologene: 3236
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Birc1f, Naip-rs4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Vmn1r58
Name: vomeronasal 1 receptor 58
Synonyms: V3R4, V1rd4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81014
Homologene: 41799
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Lox
Name: lysyl oxidase
Synonyms: TSC-160, ras recision gene (rrg)
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16948
VEGA: 18
HGNC: HGNC:6664
Homologene: 1741
Insr
Name: insulin receptor
Synonyms: IR-B, 4932439J01Rik, D630014A15Rik, IR, CD220, IR-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16337
HGNC: HGNC:6091
Homologene: 20090
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: alphaA-CRYBP1, Cryabp1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Yipf3
Name: Yip1 domain family, member 3
Synonyms: D17Wsu94e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 28064
Homologene: 9117
Mrpl21
Name: mitochondrial ribosomal protein L21
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353242
Homologene: 32936
Dclre1a
Name: DNA cross-link repair 1A
Synonyms: mSNM1, SMN1a, 2810043H12Rik, SNM1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 55947
Homologene: 8920
Moxd2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194357
Homologene: 77226
Rtl1
Name: retrotransposon Gaglike 1
Synonyms: Mart1, Mar, Mor1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 353326
VEGA: 12
Homologene: 120261
Ninl
Name: ninein-like
Synonyms: LOC381388, LOC381387, 4930519N13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78177
Homologene: 57024
Rad21
Name: RAD21 cohesin complex component
Synonyms: SCC1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19357
VEGA: 15
HGNC: HGNC:9811
Homologene: 38161
Sp7
Name: Sp7 transcription factor 7
Synonyms: osterix, 6430578P22Rik, Osx
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170574
VEGA: 15
Homologene: 15607
Ugt3a2
Name: UDP glycosyltransferases 3 family, polypeptide A2
Synonyms: Ugt3a, Ugt3a1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105887
Homologene: 122787
Osgin1
Name: oxidative stress induced growth inhibitor 1
Synonyms: 1700012B18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71839
Homologene: 16325
Il10
Name: interleukin 10
Synonyms: cytokine synthesis inhibitory factor, IL-10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16153
HGNC: HGNC:5962
Homologene: 478
Phldb2
Name: pleckstrin homology like domain, family B, member 2
Synonyms: LL5b, C820004H04Rik, LL5beta
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208177
Homologene: 17100
Zdhhc23
Name: zinc finger, DHHC domain containing 23
Synonyms: LOC332175, LOC385651
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 332175
VEGA: 16
Homologene: 17840
Krtap5-1
Name: keratin associated protein 5-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50774
Or8j3c
Name: olfactory receptor family 8 subfamily J member 3C
Synonyms: GA_x6K02T2Q125-47892992-47892045, MOR185-1, Olfr1062
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259082
Homologene: 83135
Ano5
Name: anoctamin 5
Synonyms: Tmem16e, Gdd1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233246
Homologene: 100071
Zfp229
Name: zinc finger protein 229
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381067
Homologene: 136287
Megf11
Name: multiple EGF-like-domains 11
Synonyms: 2410080H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214058
Homologene: 13031
Fpr1
Name: formyl peptide receptor 1
Synonyms: fMLF-R, FPR
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14293
HGNC: HGNC:3826
Homologene: 20466
Skint7
Name: selection and upkeep of intraepithelial T cells 7
Synonyms: C130057D23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 328505
Homologene: 106613
Traf3ip2
Name: TRAF3 interacting protein 2
Synonyms: Act1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103213
HGNC: HGNC:1343
Homologene: 15885
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: very-kind, VKIND, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Tyk2
Name: tyrosine kinase 2
Synonyms: JTK1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54721
VEGA: 9
Homologene: 20712
Ncoa5
Name: nuclear receptor coactivator 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228869
Homologene: 32496
Or1e1
Name: olfactory receptor family 1 subfamily E member 1
Synonyms: GA_x6K02T2P1NL-3514066-3515010, MOR135-11, MTPCR06, Olfr21, MTPCR55, Olfr20
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258925
Homologene: 128054
Vmn1r212
Name: vomeronasal 1 receptor 212
Synonyms: V1rh18
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171275
Homologene: 110880
Upp2
Name: uridine phosphorylase 2
Synonyms: UPASE2, 1700124F02Rik, UP2, UDRPASE2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76654
Homologene: 12654
Cibar2
Name: CBY1 interacting BAR domain containing 2
Synonyms: Fam92b, 1700120B06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 436062
Homologene: 78513
Setbp1
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240427
Homologene: 9192
Dok6
Name: docking protein 6
Synonyms: Dok-6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 623279
Homologene: 45143
Ankdd1b
Name: ankyrin repeat and death domain containing 1B
Synonyms: 9330128J19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 271144
Homologene: 19566
Fscn3
Name: fascin actin-bundling protein 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56223
HGNC: HGNC:3961
Homologene: 10475
Tas2r108
Name: taste receptor, type 2, member 108
Synonyms: T2R8, mGR08, mt2r8, T2r8, T2R108
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57253
Homologene: 49480
Gabra4
Name: gamma-aminobutyric acid type A receptor subunit alpha 4
Synonyms: Gabra-4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14397
HGNC: HGNC:4078
Homologene: 631
Or5v1
Name: olfactory receptor family 5 subfamily V member 1
Synonyms: MOR249-2, GA_x6K02T2PSCP-1956307-1957260, Olfr110
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258325
Homologene: 73968
Ikbip
Name: IKBKB interacting protein
Synonyms: 1200009F10Rik, 1700023M03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67454
Homologene: 12138
Slc25a1
Name: solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1
Synonyms: Dgsj, Slc20a3, 2610100G11Rik, 1300019P08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13358
Homologene: 4362
Trgc1
Name: T cell receptor gamma, constant 1
Synonyms: Gm17004, Tcrg-C1, Cgamma1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107573
Gm45861
Name: predicted gene 45861
Type: Gene
Species: Mouse
Chromosome: 8
Tcta
Name: T cell leukemia translocation altered gene
Synonyms: C85065, 9130410M22Rik, Tctal
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102791
Homologene: 11161
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 75,476,627 bp
  • A to G, chromosome 1 at 131,020,068 bp
  • A to T, chromosome 1 at 178,322,561 bp
  • G to T, chromosome 2 at 58,774,115 bp
  • C to T, chromosome 2 at 69,464,784 bp
  • A to G, chromosome 2 at 86,423,239 bp
  • A to G, chromosome 2 at 132,750,590 bp
  • A to T, chromosome 2 at 150,966,096 bp
  • T to C, chromosome 2 at 165,012,896 bp
  • A to T, chromosome 3 at 90,122,729 bp
  • A to G, chromosome 3 at 96,155,373 bp
  • A to T, chromosome 4 at 45,900,461 bp
  • G to T, chromosome 4 at 111,982,226 bp
  • A to T, chromosome 4 at 145,103,676 bp
  • A to C, chromosome 5 at 71,640,913 bp
  • T to C, chromosome 5 at 117,555,264 bp
  • A to G, chromosome 6 at 28,430,176 bp
  • T to C, chromosome 6 at 40,493,856 bp
  • T to A, chromosome 6 at 40,885,444 bp
  • T to C, chromosome 7 at 5,411,243 bp
  • T to A, chromosome 7 at 45,376,790 bp
  • T to G, chromosome 7 at 51,587,732 bp
  • T to C, chromosome 7 at 100,033,656 bp
  • A to G, chromosome 7 at 120,475,466 bp
  • T to C, chromosome 7 at 128,694,802 bp
  • T to A, chromosome 7 at 139,923,816 bp
  • ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG to ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG, chromosome 7 at 142,296,596 bp
  • T to C, chromosome 8 at 3,258,415 bp
  • T to C, chromosome 8 at 27,582,723 bp
  • G to A, chromosome 8 at 119,445,034 bp
  • T to C, chromosome 8 at 120,166,633 bp
  • A to T, chromosome 9 at 21,124,967 bp
  • G to T, chromosome 9 at 22,362,723 bp
  • G to A, chromosome 9 at 64,695,427 bp
  • A to G, chromosome 9 at 108,305,787 bp
  • A to T, chromosome 10 at 5,132,078 bp
  • C to G, chromosome 10 at 39,626,455 bp
  • C to T, chromosome 10 at 80,410,467 bp
  • A to G, chromosome 10 at 80,550,738 bp
  • C to T, chromosome 10 at 85,888,050 bp
  • T to C, chromosome 10 at 91,101,755 bp
  • T to C, chromosome 11 at 59,077,950 bp
  • A to T, chromosome 11 at 68,829,980 bp
  • C to A, chromosome 11 at 73,353,759 bp
  • G to A, chromosome 11 at 104,733,713 bp
  • G to A, chromosome 12 at 44,541,075 bp
  • C to T, chromosome 12 at 109,594,155 bp
  • A to C, chromosome 13 at 8,836,875 bp
  • A to T, chromosome 13 at 19,216,521 bp
  • A to T, chromosome 13 at 22,883,153 bp
  • T to C, chromosome 13 at 42,155,352 bp
  • T to C, chromosome 13 at 55,475,509 bp
  • T to C, chromosome 13 at 96,419,798 bp
  • T to C, chromosome 13 at 100,144,409 bp
  • T to A, chromosome 13 at 100,315,471 bp
  • A to G, chromosome 14 at 34,237,566 bp
  • A to G, chromosome 14 at 51,764,072 bp
  • G to A, chromosome 15 at 9,311,817 bp
  • T to C, chromosome 15 at 51,973,142 bp
  • A to C, chromosome 15 at 102,359,098 bp
  • A to G, chromosome 16 at 17,926,274 bp
  • A to G, chromosome 16 at 43,971,544 bp
  • T to A, chromosome 16 at 45,751,364 bp
  • T to C, chromosome 16 at 48,498,784 bp
  • A to T, chromosome 17 at 17,877,372 bp
  • A to T, chromosome 17 at 21,746,150 bp
  • G to T, chromosome 17 at 37,498,977 bp
  • T to C, chromosome 17 at 46,250,864 bp
  • C to A, chromosome 17 at 71,230,274 bp
  • A to T, chromosome 18 at 52,525,122 bp
  • G to A, chromosome 18 at 78,783,424 bp
  • A to T, chromosome 18 at 89,560,058 bp
  • T to C, chromosome 19 at 3,287,752 bp
  • A to T, chromosome 19 at 56,531,252 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7840 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045894-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.