Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7845Btlr/Mmmh
Stock Number:
045899-MU
Citation ID:
RRID:MMRRC_045899-MU
Other Names:
R7845 (G1)
Major Collection:

Strain Information

Bcl2l2
Name: BCL2-like 2
Synonyms: bclw, Gtrgal2, Gtrosa41, Bcl-w
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12050
HGNC: HGNC:995
Homologene: 2989
Slc2a1
Name: solute carrier family 2 (facilitated glucose transporter), member 1
Synonyms: Glut-1, Glut1, M100200, Rgsc200
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20525
Homologene: 68520
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Dnajc21
Name: DnaJ heat shock protein family (Hsp40) member C21
Synonyms: 9930116P15Rik, 4930461P20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78244
Homologene: 6752
Micu1
Name: mitochondrial calcium uptake 1
Synonyms: C730016L05Rik, Cbara1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216001
HGNC: HGNC:1530
Homologene: 4431
Xrcc6
Name: X-ray repair complementing defective repair in Chinese hamster cells 6
Synonyms: Ku p70, Ku70, G22p1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14375
HGNC: HGNC:4055
Homologene: 37483
Cobl
Name: cordon-bleu WH2 repeat
Synonyms: C530045F18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12808
Homologene: 9058
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
HGNC: HGNC:9848
Homologene: 87808
Ccdc14
Name: coiled-coil domain containing 14
Synonyms: G630039H03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239839
VEGA: 16
Homologene: 32549
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Sec23b
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27054
Homologene: 74571
Wdr62
Name: WD repeat domain 62
Synonyms: 2310038K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233064
Homologene: 15927
Dars2
Name: aspartyl-tRNA synthetase 2 (mitochondrial)
Synonyms: 5830468K18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226539
Homologene: 7093
Syt17
Name: synaptotagmin XVII
Synonyms: Bk
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 110058
Homologene: 9553
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68187
Homologene: 32665
Ints2
Name: integrator complex subunit 2
Synonyms: 2810417D08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70422
Homologene: 10801
Fads1
Name: fatty acid desaturase 1
Synonyms: 0710001O03Rik, A930006B21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76267
VEGA: 19
HGNC: HGNC:3574
Homologene: 22753
Mis18bp1
Name: MIS18 binding protein 1
Synonyms: C79407
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217653
Homologene: 10147
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Irbp, Rbp-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Cpne2
Name: copine II
Synonyms: 3322401K10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234577
HGNC: HGNC:2315
Homologene: 27392
Mtpap
Name: mitochondrial poly(A) polymerase
Synonyms: 0610027A18Rik, Papd1, Tent6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67440
VEGA: 18
Homologene: 10008
Eif2ak2
Name: eukaryotic translation initiation factor 2-alpha kinase 2
Synonyms: eIF-2 alpha, Pkr, dsRNA-activated kinase, IFN- type I-induced and dsRNA-activated kinase, IFN-induced and double-stranded RNA-activated kinase, Prkr, Tik, eIF-2 alpha, 4732414G15Rik, 2310047A08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19106
HGNC: HGNC:9437
Homologene: 48134
Exoc3l
Name: exocyst complex component 3-like
Synonyms: C730015A04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277978
Homologene: 18629
Rfx6
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320995
Homologene: 18318
Fbxw14
Name: F-box and WD-40 domain protein 14
Synonyms: Fbx12, E330009N23Rik, Fbxo12
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50757
Homologene: 110776
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, MX, 4931438M07Rik, 1700052O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Tsks
Name: testis-specific serine kinase substrate
Synonyms: clone 4, Tssks1, Tsks, Stk22s1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22116
Homologene: 7984
Or13p8
Name: olfactory receptor family 13 subfamily P member 8
Synonyms: GA_x6K02T2QD9B-18823451-18822504, MOR258-6, Olfr1340
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258301
Homologene: 122779
Fam118a
Name: family with sequence similarity 118, member A
Synonyms: C230014M12Rik, 3110048E14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73225
VEGA: 15
HGNC: HGNC:1313
Homologene: 9911
Sec14l3
Name: SEC14-like lipid binding 3
Synonyms: 1110069O07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380683
Homologene: 24848
Gemin6
Name: gem nuclear organelle associated protein 6
Synonyms: 2610019B15Rik, 2810470M17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67242
Homologene: 11711
Adat2
Name: adenosine deaminase, tRNA-specific 2
Synonyms: 4933426M09Rik, Deadc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66757
Homologene: 6262
Mast1
Name: microtubule associated serine/threonine kinase 1
Synonyms: 9430008B02Rik, SAST170, SAST
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56527
Homologene: 10543
4921509C19Rik
Name: RIKEN cDNA 4921509C19 gene
Synonyms: LOC381389
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381393
Homologene: 72396
D7Ertd443e
Name: DNA segment, Chr 7, ERATO Doi 443, expressed
Synonyms: 4933400E14Rik, Fats
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71007
Homologene: 18998
Bglap2
Name: bone gamma-carboxyglutamate protein 2
Synonyms: osteocalcin, mOC-B, bone Gla protein, OG2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12097
HGNC: HGNC:1043
Homologene: 104130
A430078G23Rik
Name: RIKEN cDNA A430078G23 gene
Type: Gene
Species: Mouse
Chromosome: 8
Acot2
Name: acyl-CoA thioesterase 2
Synonyms: MTE-I, Mte1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 171210
Homologene: 25661
Or4k44
Name: olfactory receptor family 4 subfamily K member 44
Synonyms: GA_x6K02T2Q125-72589785-72588847, MOR248-7, Olfr1294
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258887
Homologene: 74216
Ptx4
Name: pentraxin 4
Synonyms: 1110018H23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68509
VEGA: 17
Homologene: 19179
Or51f23
Name: olfactory receptor family 51 subfamily F member 23
Synonyms: GA_x6K02T2PBJ9-5513635-5514627, MOR14-10, Olfr564
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258356
Homologene: 121507
Mrps28
Name: mitochondrial ribosomal protein S28
Synonyms: 1500012D08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66230
Homologene: 8519
Stra8
Name: stimulated by retinoic acid gene 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20899
Homologene: 49197
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 24,029,657 bp
  • A to T, chromosome 1 at 161,041,748 bp
  • C to A, chromosome 2 at 111,538,167 bp
  • T to A, chromosome 2 at 144,559,396 bp
  • T to C, chromosome 2 at 151,472,309 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • T to A, chromosome 3 at 8,923,715 bp
  • T to A, chromosome 3 at 88,378,694 bp
  • T to C, chromosome 4 at 118,726,961 bp
  • T to C, chromosome 4 at 119,135,928 bp
  • T to C, chromosome 4 at 136,936,401 bp
  • A to G, chromosome 5 at 32,903,915 bp
  • A to G, chromosome 6 at 34,930,964 bp
  • T to A, chromosome 6 at 132,777,870 bp
  • A to G, chromosome 7 at 30,265,242 bp
  • C to A, chromosome 7 at 44,953,744 bp
  • G to C, chromosome 7 at 80,368,865 bp
  • G to A, chromosome 7 at 102,804,285 bp
  • A to T, chromosome 7 at 118,409,971 bp
  • A to G, chromosome 7 at 134,270,248 bp
  • T to C, chromosome 8 at 3,386,959 bp
  • C to A, chromosome 8 at 84,925,325 bp
  • A to G, chromosome 8 at 94,551,204 bp
  • G to C, chromosome 8 at 105,290,150 bp
  • A to T, chromosome 9 at 18,640,773 bp
  • T to A, chromosome 9 at 109,287,603 bp
  • G to T, chromosome 10 at 13,552,997 bp
  • T to A, chromosome 10 at 51,678,026 bp
  • G to A, chromosome 10 at 58,447,022 bp
  • T to C, chromosome 10 at 59,839,785 bp
  • A to T, chromosome 10 at 86,996,894 bp
  • T to A, chromosome 11 at 4,067,972 bp
  • T to C, chromosome 11 at 12,365,139 bp
  • A to T, chromosome 11 at 86,238,263 bp
  • A to G, chromosome 12 at 65,149,328 bp
  • G to T, chromosome 12 at 83,992,988 bp
  • A to G, chromosome 13 at 9,609,044 bp
  • G to T, chromosome 14 at 33,956,464 bp
  • A to G, chromosome 14 at 54,884,851 bp
  • T to G, chromosome 15 at 10,447,141 bp
  • T to C, chromosome 15 at 82,016,477 bp
  • T to A, chromosome 15 at 85,045,851 bp
  • T to C, chromosome 16 at 34,715,364 bp
  • T to C, chromosome 17 at 25,124,954 bp
  • G to T, chromosome 17 at 78,863,898 bp
  • A to G, chromosome 17 at 80,225,661 bp
  • T to A, chromosome 18 at 4,387,134 bp
  • T to A, chromosome 19 at 10,194,041 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7845 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045899-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.