Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7847Btlr/Mmmh
Stock Number:
045901-MU
Citation ID:
RRID:MMRRC_045901-MU
Other Names:
R7847 (G1)
Major Collection:

Strain Information

Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Lrrfip2
Name: leucine rich repeat (in FLII) interacting protein 2
Synonyms: 5133400F20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71268
HGNC: HGNC:6703
Homologene: 22476
Dock6
Name: dedicator of cytokinesis 6
Synonyms: 2410095B20Rik, 4931431C02Rik, C330023D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Specc1l
Name: sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms: 4930470P14Rik, 9530057A13Rik, 4932439K10Rik, Specc1l, Cytsa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74392
VEGA: 10
Homologene: 15610
Mtcl1
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, 1110012J17Rik, Soga2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68617
Homologene: 41017
Zfp341
Name: zinc finger protein 341
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228807
Homologene: 13127
Knl1
Name: kinetochore scaffold 1
Synonyms: 2310043D08Rik, 5730505K17Rik, Casc5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76464
Homologene: 44890
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, rjs, D7H15F37S1, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Dcp1b
Name: decapping mRNA 1B
Synonyms: B930050E02Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319618
Homologene: 51881
Grin2c
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NMDAR2C, NR2C, GluRepsilon3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14813
HGNC: HGNC:4587
Homologene: 647
Erbb3
Name: erb-b2 receptor tyrosine kinase 3
Synonyms: Erbb-3, Erbb3r, HER3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13867
HGNC: HGNC:3431
Homologene: 20457
2300002M23Rik
Name: RIKEN cDNA 2300002M23 gene
Synonyms: emprin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69542
Homologene: 49368
Il17rb
Name: interleukin 17 receptor B
Synonyms: Evi27, IL-17ER, IL17RH1, IL-17Rh1, Il17br
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50905
Homologene: 10287
Mtfr2
Name: mitochondrial fission regulator 2
Synonyms: 4933412C16Rik, 2610016C23Rik, Fam54a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71804
VEGA: 10
Homologene: 69441
Rad54b
Name: RAD54 homolog B (S. cerevisiae)
Synonyms: E130016E03Rik, E130016E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 623474
Homologene: 8240
Trak2
Name: trafficking protein, kinesin binding 2
Synonyms: GRIF-1, CALS-C, OIP98, GRIF1, 4733401O11Rik, Als2cr3, 2900022D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70827
Homologene: 22861
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Kcng4
Name: potassium voltage-gated channel, subfamily G, member 4
Synonyms: KV6.4, KV6.3, 4921535I01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66733
Homologene: 23553
Or8g35
Name: olfactory receptor family 8 subfamily G member 35
Synonyms: GA_x6K02T2PVTD-33167297-33166353, MOR171-34, MOR171-50, Olfr955
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258242
VEGA: 9
Homologene: 133698
Cyp2b10
Name: cytochrome P450, family 2, subfamily b, polypeptide 10
Synonyms: p16, Cyp2b, phenobarbitol inducible, type b, Cyp2b20
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13088
HGNC: HGNC:2615
Homologene: 73894
Pard3b
Name: par-3 family cell polarity regulator beta
Synonyms: 2810455B10Rik, PAR3beta, PAR3L, PAR3B, 2010002N16Rik, Als2cr19, 1810008K04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72823
Homologene: 35389
Arhgef5
Name: Rho guanine nucleotide exchange factor 5
Synonyms: 2210412D05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54324
Homologene: 66300
Phactr1
Name: phosphatase and actin regulator 1
Synonyms: Rpel1, 9630030F18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218194
Homologene: 33597
Or10ak14
Name: olfactory receptor family 10 subfamily AK member 14
Synonyms: MOR259-4P, GA_x6K02T2QD9B-18795136-18796077, MOR259-4P, MOR259-9, Olfr1524-ps1, Olfr1338
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258259
Homologene: 115537
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Ttyh2
Name: tweety family member 2
Synonyms: 1110001A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 117160
Homologene: 41882
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, MX, 4931438M07Rik, 1700052O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Lmntd2
Name: lamin tail domain containing 2
Synonyms: 1600016N20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72000
Homologene: 104159
Lipo4
Name: lipase, member O4
Synonyms: Gm6857
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 628236
Homologene: 103863
Aldoart1
Name: aldolase 1 A, retrogene 1
Synonyms: Aldo1-ps2, 4921524E03Rik, Aldoa-ps2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 353204
Homologene: 128442
Asb15
Name: ankyrin repeat and SOCS box-containing 15
Synonyms: 4930400E23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78910
Homologene: 43797
Or7a38
Name: olfactory receptor family 7 subfamily A member 38
Synonyms: GA_x6K02T03FR9-4826-3919, GA_x6K02T2QGN0-2895081-2894349, MOR185-8, MOR139-7, MOR139-5, EG257869, Olfr233-ps1, Olfr1354
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 259163
Homologene: 136441
Xirp1
Name: xin actin-binding repeat containing 1
Synonyms: Xin, mXin alpha, Cmya1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22437
VEGA: 9
Homologene: 7998
Vmn2r17
Name: vomeronasal 2, receptor 17
Synonyms: EG384221
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384221
Homologene: 104825
BB014433
Name: expressed sequence BB014433
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434285
Zfp780b
Name: zinc finger protein 780B
Synonyms: B230208L21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338354
Homologene: 85969
Senp5
Name: SUMO/sentrin specific peptidase 5
Synonyms: A730063F07Rik, 6230429P13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320213
Homologene: 17647
Ccdc17
Name: coiled-coil domain containing 17
Synonyms: 1100001F07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 622665
Homologene: 77410
Acp2
Name: acid phosphatase 2, lysosomal
Synonyms: Acp-2, LAP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11432
HGNC: HGNC:123
Homologene: 1217
Alg9
Name: ALG9 alpha-1,2-mannosyltransferase
Synonyms: 8230402H15Rik, B430313H07Rik, Dibd1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102580
Homologene: 6756
Ephx1
Name: epoxide hydrolase 1, microsomal
Synonyms: Eph-1, Eph1, mEH
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13849
HGNC: HGNC:3401
Homologene: 94
Ndufaf1
Name: NADH:ubiquinone oxidoreductase complex assembly factor 1
Synonyms: CGI-65, CIA30, 2410001M24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69702
Homologene: 32289
Mup17
Name: major urinary protein 17
Synonyms: Gm12557
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100039206
Homologene: 74304
Gm17334
Name: predicted gene, 17334
Type: Gene
Species: Mouse
Chromosome: 11
Vmn2r41
Name: vomeronasal 2, receptor 41
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042848
Homologene: 113703
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 58,935,818 bp
  • A to G, chromosome 1 at 62,343,934 bp
  • A to G, chromosome 1 at 181,001,861 bp
  • G to A, chromosome 1 at 188,430,808 bp
  • C to T, chromosome 2 at 91,210,732 bp
  • G to A, chromosome 2 at 119,070,976 bp
  • A to T, chromosome 2 at 119,660,053 bp
  • A to C, chromosome 2 at 128,669,908 bp
  • T to C, chromosome 2 at 154,634,194 bp
  • A to G, chromosome 3 at 90,151,123 bp
  • T to A, chromosome 4 at 11,612,655 bp
  • T to A, chromosome 4 at 61,593,219 bp
  • C to T, chromosome 4 at 72,851,956 bp
  • A to G, chromosome 4 at 116,599,906 bp
  • G to T, chromosome 4 at 118,754,368 bp
  • A to G, chromosome 5 at 109,420,197 bp
  • C to A, chromosome 6 at 24,564,267 bp
  • C to A, chromosome 6 at 43,275,135 bp
  • T to C, chromosome 6 at 119,215,295 bp
  • A to G, chromosome 7 at 8,161,548 bp
  • C to A, chromosome 7 at 24,181,035 bp
  • T to C, chromosome 7 at 25,897,760 bp
  • A to C, chromosome 7 at 27,964,418 bp
  • T to C, chromosome 7 at 56,157,560 bp
  • G to C, chromosome 7 at 80,368,865 bp
  • T to C, chromosome 7 at 141,210,150 bp
  • GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,042,160 bp
  • A to G, chromosome 8 at 119,626,142 bp
  • A to T, chromosome 9 at 21,801,207 bp
  • A to G, chromosome 9 at 39,470,505 bp
  • T to C, chromosome 9 at 50,789,605 bp
  • T to C, chromosome 9 at 111,213,880 bp
  • G to T, chromosome 9 at 120,019,753 bp
  • G to A, chromosome 10 at 20,357,452 bp
  • T to C, chromosome 10 at 75,309,836 bp
  • T to A, chromosome 10 at 78,916,896 bp
  • G to A, chromosome 10 at 128,571,189 bp
  • T to A, chromosome 11 at 53,772,738 bp
  • T to C, chromosome 11 at 114,675,674 bp
  • G to A, chromosome 11 at 115,260,978 bp
  • T to C, chromosome 13 at 43,057,188 bp
  • A to G, chromosome 14 at 29,996,806 bp
  • T to C, chromosome 14 at 118,627,480 bp
  • C to T, chromosome 16 at 31,990,173 bp
  • A to G, chromosome 16 at 36,931,920 bp
  • T to A, chromosome 17 at 35,568,652 bp
  • T to C, chromosome 17 at 66,344,333 bp
  • A to T, chromosome 19 at 33,514,199 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7847 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045901-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.