Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7847Btlr/Mmmh
Stock Number:
045901-MU
Citation ID:
RRID:MMRRC_045901-MU
Other Names:
R7847 (G1)
Major Collection:

Strain Information

Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Lrrfip2
Name: leucine rich repeat (in FLII) interacting protein 2
Synonyms: 5133400F20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71268
HGNC: HGNC:6703
Homologene: 22476
Dock6
Name: dedicator of cytokinesis 6
Synonyms: 2410095B20Rik, 4931431C02Rik, C330023D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Specc1l
Name: sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms: 4930470P14Rik, 9530057A13Rik, 4932439K10Rik, Specc1l, Cytsa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74392
VEGA: 10
Homologene: 15610
Mtcl1
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, 1110012J17Rik, Soga2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68617
Homologene: 41017
Zfp341
Name: zinc finger protein 341
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228807
Homologene: 13127
Knl1
Name: kinetochore scaffold 1
Synonyms: 2310043D08Rik, 5730505K17Rik, Casc5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76464
Homologene: 44890
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 58,935,818 bp
  • A to G, chromosome 1 at 62,343,934 bp
  • A to G, chromosome 1 at 181,001,861 bp
  • G to A, chromosome 1 at 188,430,808 bp
  • C to T, chromosome 2 at 91,210,732 bp
  • G to A, chromosome 2 at 119,070,976 bp
  • A to T, chromosome 2 at 119,660,053 bp
  • A to C, chromosome 2 at 128,669,908 bp
  • T to C, chromosome 2 at 154,634,194 bp
  • A to G, chromosome 3 at 90,151,123 bp
  • T to A, chromosome 4 at 11,612,655 bp
  • T to A, chromosome 4 at 61,593,219 bp
  • C to T, chromosome 4 at 72,851,956 bp
  • A to G, chromosome 4 at 116,599,906 bp
  • G to T, chromosome 4 at 118,754,368 bp
  • A to G, chromosome 5 at 109,420,197 bp
  • C to A, chromosome 6 at 24,564,267 bp
  • C to A, chromosome 6 at 43,275,135 bp
  • T to C, chromosome 6 at 119,215,295 bp
  • A to G, chromosome 7 at 8,161,548 bp
  • C to A, chromosome 7 at 24,181,035 bp
  • T to C, chromosome 7 at 25,897,760 bp
  • A to C, chromosome 7 at 27,964,418 bp
  • T to C, chromosome 7 at 56,157,560 bp
  • G to C, chromosome 7 at 80,368,865 bp
  • T to C, chromosome 7 at 141,210,150 bp
  • GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,042,160 bp
  • A to G, chromosome 8 at 119,626,142 bp
  • A to T, chromosome 9 at 21,801,207 bp
  • A to G, chromosome 9 at 39,470,505 bp
  • T to C, chromosome 9 at 50,789,605 bp
  • T to C, chromosome 9 at 111,213,880 bp
  • G to T, chromosome 9 at 120,019,753 bp
  • G to A, chromosome 10 at 20,357,452 bp
  • T to C, chromosome 10 at 75,309,836 bp
  • T to A, chromosome 10 at 78,916,896 bp
  • G to A, chromosome 10 at 128,571,189 bp
  • T to A, chromosome 11 at 53,772,738 bp
  • T to C, chromosome 11 at 114,675,674 bp
  • G to A, chromosome 11 at 115,260,978 bp
  • T to C, chromosome 13 at 43,057,188 bp
  • A to G, chromosome 14 at 29,996,806 bp
  • T to C, chromosome 14 at 118,627,480 bp
  • C to T, chromosome 16 at 31,990,173 bp
  • A to G, chromosome 16 at 36,931,920 bp
  • T to A, chromosome 17 at 35,568,652 bp
  • T to C, chromosome 17 at 66,344,333 bp
  • A to T, chromosome 19 at 33,514,199 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7847 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045901-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.