Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7854Btlr/Mmmh
Stock Number:
045907-MU
Citation ID:
RRID:MMRRC_045907-MU
Other Names:
R7854 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Kcns2
Name: K+ voltage-gated channel, subfamily S, 2
Synonyms: Kv9.2, E130006J24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16539
VEGA: 15
HGNC: HGNC:6301
Homologene: 22465
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: CS group B correcting gene, CSB, C130058G22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Itpr-1, Ip3r, Pcp-1, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Parp4
Name: poly (ADP-ribose) polymerase family, member 4
Synonyms: VPARP, VAULT3, p193, PH5P, E230037B21Rik, Adprtl1, C030027K23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328417
HGNC: HGNC:271
Homologene: 124423
Wwc2
Name: WW, C2 and coiled-coil domain containing 2
Synonyms: D8Ertd594e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52357
Homologene: 32618
Srp68
Name: signal recognition particle 68
Synonyms: 2610024I03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217337
Homologene: 7056
Cep63
Name: centrosomal protein 63
Synonyms: CD20R, ET2, D9Mgc41, D9Mgc48e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 28135
Homologene: 11861
Dpep2
Name: dipeptidase 2
Synonyms: MBD-2, F630103D06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319446
Homologene: 49703
Calcoco1
Name: calcium binding and coiled coil domain 1
Synonyms: 1810009B06Rik, CoCoA, Gcap11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67488
Homologene: 10845
Pex19
Name: peroxisomal biogenesis factor 19
Synonyms: Pxf, peroxisome biogenesis factor 19
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19298
HGNC: HGNC:9713
Homologene: 134253
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Mtx2
Name: metaxin 2
Synonyms: 1500012G02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53375
HGNC: HGNC:7506
Homologene: 4777
Gps2
Name: G protein pathway suppressor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56310
HGNC: HGNC:4550
Homologene: 49599
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 252972
Homologene: 9905
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
Dennd5b
Name: DENN domain containing 5B
Synonyms: 9330160C06Rik, D030011O10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320560
Homologene: 44911
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Or51f2
Name: olfactory receptor family 51 subfamily F member 2
Synonyms: GA_x6K02T2PBJ9-5588278-5589228, MOR14-3, MOR14-11, Olfr568
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259095
Homologene: 81595
Glce
Name: glucuronyl C5-epimerase
Synonyms: heparan sulfate-glucuronic acid C5-epimerase, Hsepi, C130034A12Rik, 1110017N23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 93683
Homologene: 14111
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Taar1
Name: trace amine-associated receptor 1
Synonyms: Tar1, Trar1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 111174
VEGA: 10
Homologene: 24938
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Vmn1r231
Name: vomeronasal 1 receptor 231
Synonyms: V1re7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171230
Kcnh6
Name: potassium voltage-gated channel, subfamily H (eag-related), member 6
Synonyms: m-erg2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192775
Homologene: 32740
Rasgrp4
Name: RAS guanyl releasing protein 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233046
Homologene: 15635
Tle5
Name: TLE family member 5, transcriptional modulator
Synonyms: Grg5, Grg, AES, Aes
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14797
VEGA: 10
HGNC: HGNC:307
Homologene: 879
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Atp9a
Name: ATPase, class II, type 9A
Synonyms: Class II, IIa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
Ogn
Name: osteoglycin
Synonyms: OG, 3110079A16Rik, mimican, SLRR3A, mimecan
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18295
VEGA: 13
HGNC: HGNC:8126
Homologene: 8542
Or1ak2
Name: olfactory receptor family 1 subfamily AK member 2
Synonyms: GA_x6K02T2NLDC-33631647-33632594, MOR134-1, Olfr356
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258617
Homologene: 85948
Als2cl
Name: ALS2 C-terminal like
Synonyms: mRn.49018, D930044G19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235633
Homologene: 17152
Ms4a20
Name: membrane-spanning 4-domains, subfamily A, member 20
Synonyms: 1700017D01Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69369
Gfer
Name: growth factor, augmenter of liver regeneration
Synonyms: ERV1, Alr
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11692
VEGA: 17
HGNC: HGNC:4236
Homologene: 55884
Ap1g2
Name: adaptor protein complex AP-1, gamma 2 subunit
Synonyms: gamma 2-adaptin, Adtg2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11766
HGNC: HGNC:556
Homologene: 49141
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Tyk2
Name: tyrosine kinase 2
Synonyms: JTK1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54721
VEGA: 9
Homologene: 20712
Gramd2b
Name: GRAM domain containing 2B
Synonyms: 9030613F08Rik, 9130427A09Rik, Gramd3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107022
VEGA: 18
Homologene: 32570
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74691
Homologene: 14311
Chchd7
Name: coiled-coil-helix-coiled-coil-helix domain containing 7
Synonyms: 1810049H20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66433
Homologene: 41558
Vmn1r200
Name: vomeronasal 1 receptor 200
Synonyms: V1rh3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171246
Homologene: 110880
Prx
Name: periaxin
Synonyms: L-Periaxin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19153
Homologene: 76542
Fads6
Name: fatty acid desaturase domain family, member 6
Synonyms: OTTMUSG00000021749, BC050213
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 328035
Homologene: 18646
Ndufs2
Name: NADH:ubiquinone oxidoreductase core subunit S2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226646
HGNC: HGNC:7708
Homologene: 56659
Prss53
Name: serine protease 53
Synonyms: BC039632
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330657
Homologene: 80097
Pstpip2
Name: proline-serine-threonine phosphatase-interacting protein 2
Synonyms: cmo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19201
VEGA: 18
HGNC: HGNC:9581
Homologene: 69150
Trav2
Name: T cell receptor alpha variable 2
Synonyms: ENSMUSG00000072561
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100042372
Mptx1
Name: mucosal pentraxin 1
Synonyms: 1810030J14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66289
Homologene: 134535
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 14,881,694 bp
  • T to G, chromosome 1 at 93,006,454 bp
  • T to C, chromosome 1 at 171,239,369 bp
  • T to G, chromosome 1 at 172,126,850 bp
  • T to A, chromosome 1 at 174,218,830 bp
  • A to T, chromosome 1 at 174,332,400 bp
  • A to G, chromosome 2 at 36,938,024 bp
  • A to G, chromosome 2 at 74,868,887 bp
  • T to C, chromosome 2 at 168,648,603 bp
  • T to C, chromosome 4 at 3,943,422 bp
  • A to G, chromosome 5 at 120,549,588 bp
  • T to A, chromosome 5 at 121,329,568 bp
  • A to G, chromosome 6 at 108,387,369 bp
  • A to G, chromosome 6 at 124,517,741 bp
  • T to C, chromosome 6 at 149,068,466 bp
  • T to C, chromosome 7 at 27,362,410 bp
  • T to A, chromosome 7 at 27,516,641 bp
  • C to T, chromosome 7 at 29,150,610 bp
  • GGCGGCGGCGGC to GGCGGCGGCGGCGGCGGCGGCAGCGGCAGCGGCGGCGGC, chromosome 7 at 97,579,924 bp
  • C to T, chromosome 7 at 102,877,785 bp
  • T to C, chromosome 7 at 127,888,945 bp
  • G to A, chromosome 8 at 47,868,477 bp
  • T to C, chromosome 8 at 105,989,528 bp
  • A to T, chromosome 9 at 21,115,480 bp
  • A to T, chromosome 9 at 62,070,491 bp
  • A to T, chromosome 9 at 102,602,998 bp
  • A to G, chromosome 9 at 110,898,496 bp
  • A to G, chromosome 10 at 23,920,782 bp
  • T to C, chromosome 10 at 52,128,467 bp
  • A to G, chromosome 10 at 81,565,647 bp
  • T to C, chromosome 11 at 59,090,712 bp
  • T to C, chromosome 11 at 69,915,204 bp
  • A to T, chromosome 11 at 106,017,346 bp
  • A to T, chromosome 11 at 115,297,396 bp
  • G to C, chromosome 11 at 116,254,083 bp
  • T to C, chromosome 11 at 119,857,953 bp
  • T to C, chromosome 12 at 4,701,276 bp
  • A to G, chromosome 12 at 112,046,961 bp
  • T to C, chromosome 13 at 22,395,839 bp
  • A to T, chromosome 13 at 49,621,038 bp
  • T to A, chromosome 13 at 81,593,088 bp
  • T to C, chromosome 14 at 32,566,292 bp
  • A to T, chromosome 14 at 52,567,781 bp
  • A to G, chromosome 14 at 55,105,933 bp
  • A to G, chromosome 14 at 56,659,348 bp
  • T to A, chromosome 15 at 9,596,644 bp
  • A to T, chromosome 15 at 34,839,771 bp
  • A to T, chromosome 15 at 77,791,753 bp
  • T to C, chromosome 15 at 102,719,556 bp
  • T to A, chromosome 17 at 20,890,632 bp
  • C to A, chromosome 17 at 24,694,285 bp
  • A to G, chromosome 18 at 56,478,854 bp
  • C to T, chromosome 18 at 77,874,304 bp
  • T to A, chromosome 19 at 11,112,377 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7854 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045907-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.