Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7855Btlr/Mmmh
Stock Number:
045908-MU
Citation ID:
RRID:MMRRC_045908-MU
Other Names:
R7855 (G1)
Major Collection:

Strain Information

Mitf
Name: melanogenesis associated transcription factor
Synonyms: mi, wh, BCC2, bHLHe32, Gsfbcc2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17342
HGNC: HGNC:7105
Homologene: 4892
Vps33a
Name: VPS33A CORVET/HOPS core subunit
Synonyms: bf, 3830421M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77573
Homologene: 11294
Itgb8
Name: integrin beta 8
Synonyms: 4832412O06Rik, D630049N15
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320910
HGNC: HGNC:6163
Homologene: 18567
Bcl2l2
Name: BCL2-like 2
Synonyms: bclw, Gtrgal2, Gtrosa41, Bcl-w
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12050
HGNC: HGNC:995
Homologene: 2989
Pecam1
Name: platelet/endothelial cell adhesion molecule 1
Synonyms: PECAM-1, Cd31
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18613
HGNC: HGNC:8823
Homologene: 47925
Top1
Name: topoisomerase (DNA) I
Synonyms: Top-1, D130064I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21969
Homologene: 2467
Rlf
Name: rearranged L-myc fusion sequence
Synonyms: 9230110M18Rik, MommeD8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109263
Homologene: 8243
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 32,546,033 bp
  • A to C, chromosome 1 at 40,343,119 bp
  • A to G, chromosome 1 at 66,483,349 bp
  • G to T, chromosome 1 at 90,810,621 bp
  • G to A, chromosome 1 at 135,254,352 bp
  • T to C, chromosome 2 at 11,680,336 bp
  • G to A, chromosome 2 at 62,837,194 bp
  • C to T, chromosome 2 at 150,255,146 bp
  • T to A, chromosome 2 at 160,714,088 bp
  • T to G, chromosome 3 at 86,315,430 bp
  • T to C, chromosome 4 at 121,182,691 bp
  • C to A, chromosome 5 at 43,901,448 bp
  • A to T, chromosome 5 at 113,848,597 bp
  • G to A, chromosome 5 at 123,570,979 bp
  • AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC to AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC, chromosome 5 at 134,711,081 bp
  • T to C, chromosome 6 at 48,439,181 bp
  • C to T, chromosome 6 at 70,704,069 bp
  • T to A, chromosome 6 at 97,993,196 bp
  • A to G, chromosome 7 at 5,146,624 bp
  • C to T, chromosome 7 at 24,542,440 bp
  • C to T, chromosome 7 at 29,150,610 bp
  • C to T, chromosome 7 at 80,254,097 bp
  • A to G, chromosome 7 at 96,873,874 bp
  • A to G, chromosome 7 at 102,887,628 bp
  • T to A, chromosome 7 at 103,611,772 bp
  • G to T, chromosome 7 at 132,057,695 bp
  • A to G, chromosome 7 at 135,651,995 bp
  • G to T, chromosome 8 at 105,913,090 bp
  • A to G, chromosome 9 at 31,327,474 bp
  • A to C, chromosome 9 at 64,133,216 bp
  • A to C, chromosome 11 at 34,273,698 bp
  • TCACACTCGGCACA to TCACA, chromosome 11 at 50,815,240 bp
  • A to T, chromosome 11 at 99,858,184 bp
  • A to T, chromosome 11 at 105,972,379 bp
  • T to C, chromosome 11 at 106,267,566 bp
  • A to G, chromosome 11 at 106,671,750 bp
  • A to T, chromosome 11 at 110,191,628 bp
  • G to T, chromosome 11 at 116,602,240 bp
  • A to T, chromosome 12 at 55,866,053 bp
  • A to T, chromosome 12 at 88,176,083 bp
  • C to T, chromosome 12 at 119,166,772 bp
  • T to A, chromosome 13 at 11,706,623 bp
  • A to G, chromosome 13 at 54,524,832 bp
  • A to T, chromosome 13 at 67,619,948 bp
  • G to T, chromosome 14 at 26,829,329 bp
  • C to T, chromosome 14 at 54,884,379 bp
  • A to G, chromosome 15 at 9,122,241 bp
  • A to G, chromosome 15 at 9,687,895 bp
  • G to T, chromosome 16 at 14,114,201 bp
  • A to G, chromosome 16 at 63,773,560 bp
  • T to A, chromosome 17 at 18,597,868 bp
  • C to T, chromosome 17 at 23,666,017 bp
  • C to A, chromosome 17 at 24,694,285 bp
  • G to A, chromosome 17 at 46,175,248 bp
  • G to A, chromosome 18 at 84,730,046 bp
  • T to A, chromosome 19 at 7,422,256 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7855 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045908-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.