Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7860Btlr/Mmmh
Stock Number:
045913-MU
Citation ID:
RRID:MMRRC_045913-MU
Other Names:
R7860 (G1)
Major Collection:

Strain Information

Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Penk
Name: preproenkephalin
Synonyms: ENK, Penk, PPA, Penk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18619
HGNC: HGNC:8831
Homologene: 4528
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Slk
Name: STE20-like kinase
Synonyms: 9A2, mSLK, Etk4, SLK, Stk2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Pck1
Name: phosphoenolpyruvate carboxykinase 1, cytosolic
Synonyms: Pck-1, PEPCK
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18534
HGNC: HGNC:8724
Homologene: 1944
Serpina9
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9
Synonyms: Centerin, 2310014L03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71907
Homologene: 23633
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 24,237,180 bp
  • C to A, chromosome 1 at 91,444,759 bp
  • G to A, chromosome 1 at 92,574,088 bp
  • T to A, chromosome 1 at 107,157,737 bp
  • A to T, chromosome 1 at 161,241,858 bp
  • T to A, chromosome 2 at 5,803,964 bp
  • C to T, chromosome 2 at 24,926,146 bp
  • T to A, chromosome 2 at 91,773,493 bp
  • C to T, chromosome 2 at 120,030,515 bp
  • A to G, chromosome 2 at 120,266,730 bp
  • A to G, chromosome 2 at 173,155,950 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • T to A, chromosome 3 at 104,926,577 bp
  • A to G, chromosome 3 at 134,258,053 bp
  • A to T, chromosome 3 at 135,884,396 bp
  • A to G, chromosome 3 at 146,066,920 bp
  • A to G, chromosome 4 at 4,133,976 bp
  • A to T, chromosome 4 at 33,081,470 bp
  • T to A, chromosome 4 at 111,415,209 bp
  • T to C, chromosome 4 at 123,929,924 bp
  • C to T, chromosome 5 at 8,832,258 bp
  • C to T, chromosome 5 at 24,324,563 bp
  • C to T, chromosome 5 at 41,819,265 bp
  • T to A, chromosome 5 at 43,758,676 bp
  • A to T, chromosome 5 at 87,254,330 bp
  • A to G, chromosome 5 at 143,194,854 bp
  • G to A, chromosome 6 at 24,619,397 bp
  • A to T, chromosome 6 at 57,113,701 bp
  • A to G, chromosome 6 at 91,928,726 bp
  • C to T, chromosome 6 at 112,649,837 bp
  • T to A, chromosome 7 at 3,655,566 bp
  • C to A, chromosome 7 at 7,293,061 bp
  • A to T, chromosome 7 at 24,669,765 bp
  • A to T, chromosome 7 at 24,981,791 bp
  • A to T, chromosome 7 at 30,512,639 bp
  • T to A, chromosome 7 at 35,414,145 bp
  • A to G, chromosome 7 at 80,255,387 bp
  • A to G, chromosome 7 at 86,407,911 bp
  • A to T, chromosome 7 at 106,926,570 bp
  • T to A, chromosome 8 at 66,860,513 bp
  • T to C, chromosome 8 at 93,171,137 bp
  • G to T, chromosome 8 at 105,309,017 bp
  • A to G, chromosome 8 at 111,049,861 bp
  • T to A, chromosome 8 at 113,775,276 bp
  • G to A, chromosome 8 at 121,564,645 bp
  • T to G, chromosome 9 at 8,120,748 bp
  • A to T, chromosome 9 at 20,137,575 bp
  • C to A, chromosome 9 at 64,728,331 bp
  • A to G, chromosome 9 at 111,272,037 bp
  • A to T, chromosome 10 at 45,091,012 bp
  • A to C, chromosome 10 at 121,552,246 bp
  • A to T, chromosome 11 at 29,557,651 bp
  • G to T, chromosome 11 at 59,375,170 bp
  • A to G, chromosome 11 at 70,645,179 bp
  • A to T, chromosome 11 at 73,120,273 bp
  • A to T, chromosome 11 at 73,847,507 bp
  • A to T, chromosome 12 at 88,176,352 bp
  • A to T, chromosome 12 at 104,001,421 bp
  • A to T, chromosome 12 at 110,855,626 bp
  • A to G, chromosome 13 at 41,187,467 bp
  • A to T, chromosome 13 at 112,731,614 bp
  • A to G, chromosome 14 at 54,542,145 bp
  • A to G, chromosome 14 at 59,361,831 bp
  • A to T, chromosome 14 at 65,077,489 bp
  • A to T, chromosome 15 at 36,479,420 bp
  • A to C, chromosome 15 at 53,089,939 bp
  • A to G, chromosome 15 at 64,699,473 bp
  • A to G, chromosome 15 at 67,111,265 bp
  • A to T, chromosome 15 at 73,540,808 bp
  • C to T, chromosome 15 at 76,447,332 bp
  • A to T, chromosome 16 at 19,530,417 bp
  • A to T, chromosome 16 at 59,555,242 bp
  • T to C, chromosome 17 at 32,122,773 bp
  • C to A, chromosome 17 at 67,901,282 bp
  • C to T, chromosome 18 at 59,409,227 bp
  • C to A, chromosome 18 at 82,674,356 bp
  • T to A, chromosome 19 at 7,910,107 bp
  • A to G, chromosome 19 at 11,302,944 bp
  • T to A, chromosome 19 at 13,768,352 bp
  • T to G, chromosome 19 at 34,675,330 bp
  • C to T, chromosome 19 at 47,642,071 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7860 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045913-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.