Strain Name:
C57BL/6J-MtgxR7860Btlr/Mmmh
Stock Number:
045913-MU
Citation ID:
RRID:MMRRC_045913-MU
Other Names:
R7860 (G1)
Major Collection:

Strain Information

Ext1
Name: exostosin glycosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14042
HGNC: HGNC:3512
Homologene: 30957
Notch3
Name: notch 3
Synonyms: N3, hpbk
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Penk
Name: preproenkephalin
Synonyms: Penk, Penk1, ENK, PPA
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18619
HGNC: HGNC:8831
Homologene: 4528
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Slk
Name: STE20-like kinase
Synonyms: Etk4, Stk2, mSLK, SLK, 9A2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Pck1
Name: phosphoenolpyruvate carboxykinase 1, cytosolic
Synonyms: PEPCK, Pck-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18534
HGNC: HGNC:8724
Homologene: 1944
Serpina9
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9
Synonyms: 2310014L03Rik, Centerin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71907
Homologene: 23633
Prep
Name: prolyl endopeptidase
Synonyms: Pop, prolyl oligopeptidase, D10Wsu136e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19072
VEGA: 10
HGNC: HGNC:9358
Homologene: 2042
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: D030051N19Rik, 2310079H06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228361
Homologene: 18204
Fbxo31
Name: F-box protein 31
Synonyms: Fbx14, 2310046N15Rik, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Wasl
Name: WASP like actin nucleation promoting factor
Synonyms: 2900021I12Rik, Wiskott-Aldrich syndrome-like (human), 3110031I02Rik, N-WASP
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73178
Homologene: 135996
Prdx6
Name: peroxiredoxin 6
Synonyms: NSGP, acidic calcium-independent phospholipase A2, Ltw4, aiPLA2, Brp-12, Ltw-4, 1-Cys Prx, CC26, CP-3, GPx, Aop2, Lvtw-4, 9430088D19Rik, 1-cysPrx
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11758
Homologene: 3606
St7l
Name: suppression of tumorigenicity 7-like
Synonyms: St7r
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229681
Homologene: 14910
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234344
Homologene: 128518
Phf11d
Name: PHD finger protein 11D
Synonyms: D14Ertd668e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219132
Homologene: 87807
Epm2aip1
Name: EPM2A interacting protein 1
Synonyms: A930003G21Rik, EPM2A (laforin) interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77781
Homologene: 8875
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665775
Homologene: 45109
Aars1
Name: alanyl-tRNA synthetase 1
Synonyms: Aars
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234734
HGNC: HGNC:20
Homologene: 1213
Slc39a8
Name: solute carrier family 39 (metal ion transporter), member 8
Synonyms: 4933419D20Rik, ZIP8, BIGM103
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67547
Homologene: 11155
Fbxl5
Name: F-box and leucine-rich repeat protein 5
Synonyms: Fbl4, Fir4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242960
Homologene: 8129
Clhc1
Name: clathrin heavy chain linker domain containing 1
Synonyms: 1700034F02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73324
Homologene: 17569
Cxxc4
Name: CXXC finger 4
Synonyms: Idax, C030003J12Rik, 9330210J02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319478
Homologene: 11878
Bend5
Name: BEN domain containing 5
Synonyms: 2310026E23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67621
Homologene: 41574
Ms4a14
Name: membrane-spanning 4-domains, subfamily A, member 14
Synonyms: LOC383435
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 383435
Homologene: 138453
Rab11a
Name: RAB11A, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53869
HGNC: HGNC:9760
Homologene: 37903
Extl3
Name: exostosin-like glycosyltransferase 3
Synonyms: 2900009G18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54616
VEGA: 14
HGNC: HGNC:3518
Homologene: 1103
Slc38a9
Name: solute carrier family 38, member 9
Synonyms: 9430067K09Rik, 6720411P22Rik, 4833412L08Rik, 9130023D20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268706
VEGA: 13
Homologene: 18139
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329002
Homologene: 7198
Tbk1
Name: TANK-binding kinase 1
Synonyms: 1200008B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56480
VEGA: 10
Homologene: 22742
Cdc123
Name: cell division cycle 123
Synonyms: G431001I09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98828
Homologene: 4394
Arhgap28
Name: Rho GTPase activating protein 28
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268970
Homologene: 18264
Cnot3
Name: CCR4-NOT transcription complex, subunit 3
Synonyms: A930039N10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232791
HGNC: HGNC:7879
Homologene: 133900
St3gal1
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Synonyms: CMP-N-acetylneuraminate: [beta-galactosidase alpha-2,3] sialytransferase, ST3GalI, Siat4, Siat4a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20442
VEGA: 15
Homologene: 7540
Itgae
Name: integrin alpha E, epithelial-associated
Synonyms: CD103, alpha-E1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16407
HGNC: HGNC:6147
Homologene: 113560
Spdye4b
Name: speedy/RINGO cell cycle regulator family, member E4B
Synonyms: 4933411G11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330228
Homologene: 138445
Dnai3
Name: dynein axonemal intermediate chain 3
Synonyms: 4931433A13Rik, IC140, Wdr63, Ida7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242253
Homologene: 44922
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Or9s23
Name: olfactory receptor family 9 subfamily S member 23
Synonyms: Olfr1413, MOR208-1, GA_x6K02T2R7CC-81180849-81179878
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 259039
Homologene: 128165
Prss38
Name: serine protease 38
Synonyms: LOC216797, Gm249
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216797
Homologene: 18831
Atp1a3
Name: ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms: Atpa-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232975
HGNC: HGNC:801
Homologene: 113729
Zfp839
Name: zinc finger protein 839
Synonyms: 2810455K09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72805
VEGA: 12
Homologene: 49541
Slc16a12
Name: solute carrier family 16 (monocarboxylic acid transporters), member 12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240638
Homologene: 130007
Per2
Name: period circadian clock 2
Synonyms: mPer2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18627
HGNC: HGNC:8846
Homologene: 7885
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Or7e175
Name: olfactory receptor family 7 subfamily E member 175
Synonyms: MOR145-6, Olfr869, GA_x6K02T2PVTD-13878275-13879204
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258550
HGNC: HGNC:8396
Homologene: 138312
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Pgy1, Abcb1, mdr, Mdr1b, Mdr1, Pgy-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Cep126
Name: centrosomal protein 126
Synonyms: AK129341
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234915
VEGA: 9
Homologene: 28313
Mroh1
Name: maestro heat-like repeat family member 1
Synonyms: Heatr7a, D330001F17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223658
Homologene: 44882
Col9a1
Name: collagen, type IX, alpha 1
Synonyms: Col9a-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12839
HGNC: HGNC:2217
Homologene: 1393
Ugt2b37
Name: UDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms: 0610033E06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 112417
Homologene: 137225
Kcnh2
Name: potassium voltage-gated channel, subfamily H (eag-related), member 2
Synonyms: ERG1, ether a go-go related, M-erg, merg1b, LQT, merg1a, Lqt2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16511
HGNC: HGNC:6251
Homologene: 201
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Elmo3
Name: engulfment and cell motility 3
Synonyms: CED-12
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234683
Homologene: 23475
Adamts18
Name: ADAM metallopeptidase with thrombospondin type 1 motif 18
Synonyms: E130314N14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 208936
Homologene: 65241
Ces1d
Name: carboxylesterase 1D
Synonyms: TGH, Ces3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104158
HGNC: HGNC:1863
Homologene: 35606
Cep89
Name: centrosomal protein 89
Synonyms: Ccdc123, 2610507L03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72140
Homologene: 12444
Slc22a27
Name: solute carrier family 22, member 27
Synonyms: AB056442, mOAT6 related protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 171405
Homologene: 77136
Clcn4
Name: chloride channel, voltage-sensitive 4
Synonyms: Clc4-2, Clcn4-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12727
HGNC: HGNC:2022
Homologene: 68207
Vmn1r10
Name: vomeronasal 1 receptor 10
Synonyms: V1rc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113858
Homologene: 76459
Serpinb3b
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3B
Synonyms: Scca2-rs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383548
Homologene: 131278
Ttll13
Name: tubulin tyrosine ligase-like family, member 13
Synonyms: 1700111A04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269954
Homologene: 136186
Or1e33
Name: olfactory receptor family 1 subfamily E member 33
Synonyms: Olfr393, GA_x6K02T2P1NL-4004140-4003208, MOR135-7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259010
Homologene: 79335
Slc25a11
Name: solute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11
Synonyms: 2oxoc, 2310022P18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67863
Homologene: 2637
4930590J08Rik
Name: RIKEN cDNA 4930590J08 gene
Synonyms: LOC381798
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381798
Homologene: 49985
Elovl2
Name: ELOVL fatty acid elongase 2
Synonyms: Ssc2, elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 54326
Homologene: 23042
Or2l13b
Name: olfactory receptor family 2 subfamily L member 13B
Synonyms: GA_x54KRFPKG5P-15979009-15978071, Olfr168, MOR271-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258354
Homologene: 128057
Rragc
Name: Ras-related GTP binding C
Synonyms: Gtr2, TIB929, YGR163W
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54170
Homologene: 39141
Rad18
Name: RAD18 E3 ubiquitin protein ligase
Synonyms: 2810024C04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58186
Homologene: 48572
Prodh2
Name: proline dehydrogenase (oxidase) 2
Synonyms: POX1, 2510028N04Rik, MmPOX1, 2510038B11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56189
Homologene: 36381
Or14c44
Name: olfactory receptor family 14 subfamily C member 44
Synonyms: MOR221-1P, MOR221-4, MOR211-8P, GA_x6K02T2NHDJ-9695951-9695766, MOR221-1P, Olfr301, Olfr302, Olfr1531-ps1, GA_x6K02T2NHDJ-9693313-9692378
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257958
Homologene: 128067
Pla2g4d
Name: phospholipase A2, group IVD
Synonyms: Pla2delta, 2610311B01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78390
Homologene: 52252
Arrdc1
Name: arrestin domain containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215705
Homologene: 34835
Gabrr2
Name: gamma-aminobutyric acid type A receptor subunit rho 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14409
HGNC: HGNC:4091
Homologene: 20471
Or2d3c
Name: olfactory receptor family 2 subfamily D member 3C
Synonyms: GA_x6K02T2PBJ9-9307730-9306814, MOR260-7, Olfr709
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258146
Or10q12
Name: olfactory receptor family 10 subfamily Q member 12
Synonyms: Olfr1495, GA_x6K02T2RE5P-4101369-4102328, MOR266-9
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258341
Homologene: 73965
Tex101
Name: testis expressed gene 101
Synonyms: TES101RP, 1700008H15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56746
Homologene: 10555
Haus4
Name: HAUS augmin-like complex, subunit 4
Synonyms: 9430093H08Rik, D14Ertd500e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219072
VEGA: 14
Homologene: 9854
Pramel51
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
Ankrd46
Name: ankyrin repeat domain 46
Synonyms: 1110054N06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68839
VEGA: 15
Homologene: 27876
Sprr2b
Name: small proline-rich protein 2B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20756
Jmjd7
Name: jumonji domain containing 7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 433466
Homologene: 98398
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 24,237,180 bp
  • C to A, chromosome 1 at 91,444,759 bp
  • G to A, chromosome 1 at 92,574,088 bp
  • T to A, chromosome 1 at 107,157,737 bp
  • A to T, chromosome 1 at 161,241,858 bp
  • T to A, chromosome 2 at 5,803,964 bp
  • C to T, chromosome 2 at 24,926,146 bp
  • T to A, chromosome 2 at 91,773,493 bp
  • C to T, chromosome 2 at 120,030,515 bp
  • A to G, chromosome 2 at 120,266,730 bp
  • A to G, chromosome 2 at 173,155,950 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • T to A, chromosome 3 at 104,926,577 bp
  • A to G, chromosome 3 at 134,258,053 bp
  • A to T, chromosome 3 at 135,884,396 bp
  • A to G, chromosome 3 at 146,066,920 bp
  • A to G, chromosome 4 at 4,133,976 bp
  • A to T, chromosome 4 at 33,081,470 bp
  • T to A, chromosome 4 at 111,415,209 bp
  • T to C, chromosome 4 at 123,929,924 bp
  • C to T, chromosome 5 at 8,832,258 bp
  • C to T, chromosome 5 at 24,324,563 bp
  • C to T, chromosome 5 at 41,819,265 bp
  • T to A, chromosome 5 at 43,758,676 bp
  • A to T, chromosome 5 at 87,254,330 bp
  • A to G, chromosome 5 at 143,194,854 bp
  • G to A, chromosome 6 at 24,619,397 bp
  • A to T, chromosome 6 at 57,113,701 bp
  • A to G, chromosome 6 at 91,928,726 bp
  • C to T, chromosome 6 at 112,649,837 bp
  • T to A, chromosome 7 at 3,655,566 bp
  • C to A, chromosome 7 at 7,293,061 bp
  • A to T, chromosome 7 at 24,669,765 bp
  • A to T, chromosome 7 at 24,981,791 bp
  • A to T, chromosome 7 at 30,512,639 bp
  • T to A, chromosome 7 at 35,414,145 bp
  • A to G, chromosome 7 at 80,255,387 bp
  • A to G, chromosome 7 at 86,407,911 bp
  • A to T, chromosome 7 at 106,926,570 bp
  • T to A, chromosome 8 at 66,860,513 bp
  • T to C, chromosome 8 at 93,171,137 bp
  • G to T, chromosome 8 at 105,309,017 bp
  • A to G, chromosome 8 at 111,049,861 bp
  • T to A, chromosome 8 at 113,775,276 bp
  • G to A, chromosome 8 at 121,564,645 bp
  • T to G, chromosome 9 at 8,120,748 bp
  • A to T, chromosome 9 at 20,137,575 bp
  • C to A, chromosome 9 at 64,728,331 bp
  • A to G, chromosome 9 at 111,272,037 bp
  • A to T, chromosome 10 at 45,091,012 bp
  • A to C, chromosome 10 at 121,552,246 bp
  • A to T, chromosome 11 at 29,557,651 bp
  • G to T, chromosome 11 at 59,375,170 bp
  • A to G, chromosome 11 at 70,645,179 bp
  • A to T, chromosome 11 at 73,120,273 bp
  • A to T, chromosome 11 at 73,847,507 bp
  • A to T, chromosome 12 at 88,176,352 bp
  • A to T, chromosome 12 at 104,001,421 bp
  • A to T, chromosome 12 at 110,855,626 bp
  • A to G, chromosome 13 at 41,187,467 bp
  • A to T, chromosome 13 at 112,731,614 bp
  • A to G, chromosome 14 at 54,542,145 bp
  • A to G, chromosome 14 at 59,361,831 bp
  • A to T, chromosome 14 at 65,077,489 bp
  • A to T, chromosome 15 at 36,479,420 bp
  • A to C, chromosome 15 at 53,089,939 bp
  • A to G, chromosome 15 at 64,699,473 bp
  • A to G, chromosome 15 at 67,111,265 bp
  • A to T, chromosome 15 at 73,540,808 bp
  • C to T, chromosome 15 at 76,447,332 bp
  • A to T, chromosome 16 at 19,530,417 bp
  • A to T, chromosome 16 at 59,555,242 bp
  • T to C, chromosome 17 at 32,122,773 bp
  • C to A, chromosome 17 at 67,901,282 bp
  • C to T, chromosome 18 at 59,409,227 bp
  • C to A, chromosome 18 at 82,674,356 bp
  • T to A, chromosome 19 at 7,910,107 bp
  • A to G, chromosome 19 at 11,302,944 bp
  • T to A, chromosome 19 at 13,768,352 bp
  • T to G, chromosome 19 at 34,675,330 bp
  • C to T, chromosome 19 at 47,642,071 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7860 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045913-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.