Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7861Btlr/Mmmh
Stock Number:
045914-MU
Citation ID:
RRID:MMRRC_045914-MU
Other Names:
R7861 (G1)
Major Collection:

Strain Information

Mcoln3
Name: mucolipin 3
Synonyms: varitint-waddler, Va, 6720490O21Rik, TRPML3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 171166
Homologene: 10118
Aldh7a1
Name: aldehyde dehydrogenase family 7, member A1
Synonyms: Atq1, D18Wsu181e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110695
HGNC: HGNC:877
Homologene: 913
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: D730040M03Rik, 1110025P14Rik, Srd5a2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Dnajc24
Name: DnaJ heat shock protein family (Hsp40) member C24
Synonyms: MmDjC7, 2610027M02Rik, 1700030A21Rik, Zcsl3, Dph4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99349
Homologene: 41704
Zfp384
Name: zinc finger protein 384
Synonyms: C130073D16Rik, Ciz, Nmp4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269800
Homologene: 15849
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 21,350,399 bp
  • C to T, chromosome 1 at 87,982,130 bp
  • T to A, chromosome 1 at 130,159,698 bp
  • T to A, chromosome 1 at 130,814,638 bp
  • C to T, chromosome 1 at 170,874,526 bp
  • C to T, chromosome 1 at 181,616,759 bp
  • A to G, chromosome 2 at 20,805,910 bp
  • A to C, chromosome 2 at 22,816,978 bp
  • T to C, chromosome 2 at 40,697,558 bp
  • T to C, chromosome 2 at 60,628,444 bp
  • T to C, chromosome 2 at 70,108,688 bp
  • C to A, chromosome 2 at 93,835,732 bp
  • A to T, chromosome 2 at 106,002,035 bp
  • T to A, chromosome 2 at 111,490,024 bp
  • A to T, chromosome 3 at 27,468,999 bp
  • A to T, chromosome 3 at 122,934,463 bp
  • A to G, chromosome 3 at 142,781,344 bp
  • A to C, chromosome 3 at 146,124,791 bp
  • A to G, chromosome 4 at 14,826,414 bp
  • A to T, chromosome 4 at 48,397,559 bp
  • A to G, chromosome 4 at 94,946,967 bp
  • T to G, chromosome 4 at 116,693,738 bp
  • T to C, chromosome 4 at 143,897,718 bp
  • A to T, chromosome 5 at 34,217,143 bp
  • T to C, chromosome 5 at 53,144,064 bp
  • C to T, chromosome 5 at 76,147,819 bp
  • A to T, chromosome 5 at 87,242,440 bp
  • T to C, chromosome 5 at 92,431,093 bp
  • T to A, chromosome 5 at 103,649,494 bp
  • T to A, chromosome 5 at 109,087,963 bp
  • T to C, chromosome 5 at 136,252,604 bp
  • A to G, chromosome 5 at 137,407,033 bp
  • C to T, chromosome 5 at 140,564,525 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • G to A, chromosome 6 at 90,466,838 bp
  • G to T, chromosome 6 at 95,594,722 bp
  • A to T, chromosome 6 at 125,036,325 bp
  • A to T, chromosome 7 at 3,844,544 bp
  • T to A, chromosome 7 at 12,715,424 bp
  • T to A, chromosome 7 at 13,028,412 bp
  • T to C, chromosome 7 at 25,001,148 bp
  • T to C, chromosome 7 at 58,788,359 bp
  • T to A, chromosome 7 at 103,122,692 bp
  • C to A, chromosome 7 at 104,266,468 bp
  • T to A, chromosome 7 at 130,625,431 bp
  • C to A, chromosome 7 at 140,081,388 bp
  • T to G, chromosome 7 at 140,691,571 bp
  • C to A, chromosome 7 at 141,440,142 bp
  • A to G, chromosome 8 at 27,114,457 bp
  • A to G, chromosome 8 at 93,357,425 bp
  • T to A, chromosome 8 at 95,107,537 bp
  • A to G, chromosome 8 at 111,494,280 bp
  • C to T, chromosome 9 at 35,020,123 bp
  • A to G, chromosome 9 at 44,818,734 bp
  • A to T, chromosome 9 at 109,664,557 bp
  • A to G, chromosome 10 at 30,691,060 bp
  • G to A, chromosome 10 at 67,909,919 bp
  • A to G, chromosome 10 at 94,103,331 bp
  • T to A, chromosome 11 at 60,855,742 bp
  • T to C, chromosome 11 at 94,357,249 bp
  • T to C, chromosome 11 at 94,496,274 bp
  • A to T, chromosome 11 at 101,526,422 bp
  • A to T, chromosome 11 at 116,228,069 bp
  • T to C, chromosome 12 at 40,315,881 bp
  • T to A, chromosome 12 at 76,803,129 bp
  • A to G, chromosome 13 at 109,935,324 bp
  • G to A, chromosome 14 at 24,245,212 bp
  • C to A, chromosome 14 at 54,477,799 bp
  • G to T, chromosome 14 at 87,472,154 bp
  • A to G, chromosome 15 at 55,444,616 bp
  • G to A, chromosome 15 at 58,125,780 bp
  • C to T, chromosome 15 at 76,648,186 bp
  • A to G, chromosome 15 at 78,349,157 bp
  • T to A, chromosome 16 at 20,679,702 bp
  • G to T, chromosome 16 at 94,691,716 bp
  • C to A, chromosome 17 at 37,672,517 bp
  • T to A, chromosome 17 at 50,756,692 bp
  • T to G, chromosome 17 at 67,809,221 bp
  • C to A, chromosome 18 at 56,548,453 bp
  • T to C, chromosome 19 at 13,781,446 bp
  • T to C, chromosome 19 at 16,655,304 bp
  • T to A, chromosome 19 at 34,939,922 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7861 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045914-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.