Strain Name:
C57BL/6J-MtgxR7861Btlr/Mmmh
Stock Number:
045914-MU
Citation ID:
RRID:MMRRC_045914-MU
Other Names:
R7861 (G1)
Major Collection:

Strain Information

Mcoln3
Name: mucolipin 3
Synonyms: varitint-waddler, Va, 6720490O21Rik, TRPML3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 171166
Homologene: 10118
Aldh7a1
Name: aldehyde dehydrogenase family 7, member A1
Synonyms: Atq1, D18Wsu181e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110695
HGNC: HGNC:877
Homologene: 913
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: D730040M03Rik, 1110025P14Rik, Srd5a2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Dnajc24
Name: DnaJ heat shock protein family (Hsp40) member C24
Synonyms: MmDjC7, 2610027M02Rik, 1700030A21Rik, Zcsl3, Dph4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99349
Homologene: 41704
Zfp384
Name: zinc finger protein 384
Synonyms: C130073D16Rik, Ciz, Nmp4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269800
Homologene: 15849
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Prdx1
Name: peroxiredoxin 1
Synonyms: OSF-3, MSP23, Tdpx2, macrophage 23kDa stress protein, macrophase stress protein 22kDa, osteoblast specific factor 3, Trx dependent peroxide reductase 2, thioredoxin dependent peroxide reductase 2, TDX2, Paga, PrxI, PAG, Prx I, prx1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18477
HGNC: HGNC:9352
Homologene: 99789
Mysm1
Name: myb-like, SWIRM and MPN domains 1
Synonyms: C530050H10Rik, C130067A03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320713
Homologene: 66204
Suclg2
Name: succinate-Coenzyme A ligase, GDP-forming, beta subunit
Synonyms: D6Wsu120e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20917
Homologene: 2854
Wdr59
Name: WD repeat domain 59
Synonyms: 5430401O09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319481
Homologene: 38685
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, C330014J10Rik, Kif20b, Mphosph1, 33cex, magoo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Tacc2
Name: transforming, acidic coiled-coil containing protein 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57752
Homologene: 5087
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Dusp12
Name: dual specificity phosphatase 12
Synonyms: VH1, mVH1, 1190004O14Rik, ESTM36, LMW-DSP4, T-DSP4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 80915
HGNC: HGNC:3067
Homologene: 5238
Cux1
Name: cut-like homeobox 1
Synonyms: Cux, CDP, Cux-1, Cutl1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13047
HGNC: HGNC:2557
Tbc1d5
Name: TBC1 domain family, member 5
Synonyms: 1600014N05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72238
VEGA: 17
Homologene: 8834
Dhrs7b
Name: dehydrogenase/reductase 7B
Synonyms: dehydrogenase/reductase (SDR family) member 7B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216820
Homologene: 41044
Dyrk1a
Name: dual-specificity tyrosine phosphorylation regulated kinase 1a
Synonyms: Dyrk, Mnbh, D16Ertd493e, 2310043O08Rik, D16Ertd272e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13548
HGNC: HGNC:3091
Homologene: 55576
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Tdrd3
Name: tudor domain containing 3
Synonyms: 4732418C03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219249
Homologene: 12771
Usp53
Name: ubiquitin specific peptidase 53
Synonyms: Sp6, Phxr3, mbo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99526
Homologene: 34521
Fgd6
Name: FYVE, RhoGEF and PH domain containing 6
Synonyms: ZFYVE24, Etohd4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13998
Homologene: 14209
Gtf2b
Name: general transcription factor IIB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229906
HGNC: HGNC:4648
Homologene: 1158
Otud6b
Name: OTU domain containing 6B
Synonyms: 2600013N14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72201
Homologene: 6064
Eif4g1
Name: eukaryotic translation initiation factor 4, gamma 1
Synonyms: E030015G23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208643
HGNC: HGNC:3296
Homologene: 110725
Fndc3b
Name: fibronectin type III domain containing 3B
Synonyms: 1600019O04Rik, fad104
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72007
Homologene: 11244
Zfp277
Name: zinc finger protein 277
Synonyms: NIRF4, 2410017E24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 246196
VEGA: 12
Homologene: 11087
Kirrel3
Name: kirre like nephrin family adhesion molecule 3
Synonyms: Neph2, 1500010O20Rik, 2900036G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67703
Homologene: 57050
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Zftraf1
Name: zinc finger TRAF type containing 1
Synonyms: Chrp, 1110031M01Rik, Cyhr1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54151
Homologene: 32791
Atad2
Name: ATPase family, AAA domain containing 2
Synonyms: 2610509G12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70472
VEGA: 15
Homologene: 6044
Nup54
Name: nucleoporin 54
Synonyms: 3110079L04Rik, 54kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269113
Homologene: 41169
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Pde4d
Name: phosphodiesterase 4D, cAMP specific
Synonyms: dunce, Dpde3, 9630011N22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238871
HGNC: HGNC:8783
Zfyve28
Name: zinc finger, FYVE domain containing 28
Synonyms: 9630058O20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231125
Homologene: 15119
Atp10a
Name: ATPase, class V, type 10A
Synonyms: pfatp, Atp10c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11982
Homologene: 56461
Ces1h
Name: carboxylesterase 1H
Synonyms: 2310039D24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75704
HGNC: HGNC:1863
Homologene: 119757
Atp1a3
Name: ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms: Atpa-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232975
HGNC: HGNC:801
Homologene: 113729
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Usp40
Name: ubiquitin specific peptidase 40
Synonyms: B230215L03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227334
Homologene: 32400
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Or10al2
Name: olfactory receptor family 10 subfamily AL member 2
Synonyms: GA_x6K02T2PSCP-2131124-2132089, MOR263-13, Olfr118
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 404308
Homologene: 110622
Accs
Name: 1-aminocyclopropane-1-carboxylate synthase (inactive)
Synonyms: 2610203E10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329470
Homologene: 75335
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
Ugt2b37
Name: UDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms: 0610033E06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 112417
Homologene: 137225
Vmn2r56
Name: vomeronasal 2, receptor 56
Synonyms: EG629079
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 629079
Homologene: 104040
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329421
Homologene: 51393
Evpl
Name: envoplakin
Synonyms: 210kDa protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14027
HGNC: HGNC:3503
Homologene: 1506
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
Or13a17
Name: olfactory receptor family 13 subfamily A member 17
Synonyms: IB6, MOR253-2, GA_x6K02T2PBJ9-42837030-42837962, Olfr45
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18344
Homologene: 79416
Rem2
Name: rad and gem related GTP binding protein 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140743
Homologene: 11222
Trim28
Name: tripartite motif-containing 28
Synonyms: KRIP-1, KAP-1, Tif1b, MommeD9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21849
Homologene: 21175
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Csf2rb
Name: colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms: AIC2B, common beta chain, CDw131, beta c, Bc, Il5rb, Il3r, Il3rb1, Csf2rb1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12983
VEGA: 15
HGNC: HGNC:2436
Homologene: 339
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210417
Homologene: 18180
1700016H13Rik
Name: RIKEN cDNA 1700016H13 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74218
Homologene: 51637
Abcc3
Name: ATP-binding cassette, sub-family C member 3
Synonyms: 1700019L09Rik, MRP3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76408
HGNC: HGNC:54
Homologene: 68364
Trim5
Name: tripartite motif-containing 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667823
Homologene: 75345
Pidd1
Name: p53 induced death domain protein 1
Synonyms: 1200011D09Rik, Pidd, Lrdd
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57913
Homologene: 11220
Apbb1ip
Name: amyloid beta precursor protein binding family B member 1 interacting protein
Synonyms: proline-rich protein 48, Prp48, 9930118P07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54519
Homologene: 32434
Itgb6
Name: integrin beta 6
Synonyms: 4831415H04Rik, 2210409C20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16420
HGNC: HGNC:6161
Homologene: 685
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627569
Homologene: 129606
Zfp365
Name: zinc finger protein 365
Synonyms: Su48, DBZ
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216049
Homologene: 8975
Or51a5
Name: olfactory receptor family 51 subfamily A member 5
Synonyms: GA_x6K02T2PBJ9-5836380-5835439, MOR8-2, MOR8-7, Olfr586
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259115
Homologene: 131143
Adgra2
Name: adhesion G protein-coupled receptor A2
Synonyms: Tem5, 9530074E10Rik, 8430414O08Rik, Gpr124
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78560
Homologene: 13112
Or1s2
Name: olfactory receptor family 1 subfamily S member 1
Synonyms: GA_x6K02T2RE5P-4112771-4113718, MOR127-1, Olfr1496
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258991
Homologene: 17458
Fcamr
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 64435
Homologene: 12929
Or4k42
Name: olfactory receptor family 4 subfamily K member 42
Synonyms: GA_x6K02T2Q125-72541649-72540711, MOR248-9, Olfr1290
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257662
Homologene: 74248
Khdc1a
Name: KH domain containing 1A
Synonyms: Ndg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 368204
Homologene: 134524
Epn3
Name: epsin 3
Synonyms: 2310022G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71889
Homologene: 56791
Klf15
Name: Kruppel-like transcription factor 15
Synonyms: KKLF, CKLF, 1810013I09Rik, hlb444
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66277
Homologene: 8553
Caly
Name: calcyon neuron-specific vesicular protein
Synonyms: 0710001P07Rik, 1110004A22Rik, Calcyon, Drd1ip
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68566
Homologene: 9256
Fbxw25
Name: F-box and WD-40 domain protein 25
Synonyms: E330001B16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546160
Rab15
Name: RAB15, member RAS oncogene family
Synonyms: 2310012G06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104886
Homologene: 64471
Grifin
Name: galectin-related inter-fiber protein
Synonyms: E130101O17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77998
HGNC: HGNC:4577
Homologene: 14293
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 21,350,399 bp
  • C to T, chromosome 1 at 87,982,130 bp
  • T to A, chromosome 1 at 130,159,698 bp
  • T to A, chromosome 1 at 130,814,638 bp
  • C to T, chromosome 1 at 170,874,526 bp
  • C to T, chromosome 1 at 181,616,759 bp
  • A to G, chromosome 2 at 20,805,910 bp
  • A to C, chromosome 2 at 22,816,978 bp
  • T to C, chromosome 2 at 40,697,558 bp
  • T to C, chromosome 2 at 60,628,444 bp
  • T to C, chromosome 2 at 70,108,688 bp
  • C to A, chromosome 2 at 93,835,732 bp
  • A to T, chromosome 2 at 106,002,035 bp
  • T to A, chromosome 2 at 111,490,024 bp
  • A to T, chromosome 3 at 27,468,999 bp
  • A to T, chromosome 3 at 122,934,463 bp
  • A to G, chromosome 3 at 142,781,344 bp
  • A to C, chromosome 3 at 146,124,791 bp
  • A to G, chromosome 4 at 14,826,414 bp
  • A to T, chromosome 4 at 48,397,559 bp
  • A to G, chromosome 4 at 94,946,967 bp
  • T to G, chromosome 4 at 116,693,738 bp
  • T to C, chromosome 4 at 143,897,718 bp
  • A to T, chromosome 5 at 34,217,143 bp
  • T to C, chromosome 5 at 53,144,064 bp
  • C to T, chromosome 5 at 76,147,819 bp
  • A to T, chromosome 5 at 87,242,440 bp
  • T to C, chromosome 5 at 92,431,093 bp
  • T to A, chromosome 5 at 103,649,494 bp
  • T to A, chromosome 5 at 109,087,963 bp
  • T to C, chromosome 5 at 136,252,604 bp
  • A to G, chromosome 5 at 137,407,033 bp
  • C to T, chromosome 5 at 140,564,525 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • G to A, chromosome 6 at 90,466,838 bp
  • G to T, chromosome 6 at 95,594,722 bp
  • A to T, chromosome 6 at 125,036,325 bp
  • A to T, chromosome 7 at 3,844,544 bp
  • T to A, chromosome 7 at 12,715,424 bp
  • T to A, chromosome 7 at 13,028,412 bp
  • T to C, chromosome 7 at 25,001,148 bp
  • T to C, chromosome 7 at 58,788,359 bp
  • T to A, chromosome 7 at 103,122,692 bp
  • C to A, chromosome 7 at 104,266,468 bp
  • T to A, chromosome 7 at 130,625,431 bp
  • C to A, chromosome 7 at 140,081,388 bp
  • T to G, chromosome 7 at 140,691,571 bp
  • C to A, chromosome 7 at 141,440,142 bp
  • A to G, chromosome 8 at 27,114,457 bp
  • A to G, chromosome 8 at 93,357,425 bp
  • T to A, chromosome 8 at 95,107,537 bp
  • A to G, chromosome 8 at 111,494,280 bp
  • C to T, chromosome 9 at 35,020,123 bp
  • A to G, chromosome 9 at 44,818,734 bp
  • A to T, chromosome 9 at 109,664,557 bp
  • A to G, chromosome 10 at 30,691,060 bp
  • G to A, chromosome 10 at 67,909,919 bp
  • A to G, chromosome 10 at 94,103,331 bp
  • T to A, chromosome 11 at 60,855,742 bp
  • T to C, chromosome 11 at 94,357,249 bp
  • T to C, chromosome 11 at 94,496,274 bp
  • A to T, chromosome 11 at 101,526,422 bp
  • A to T, chromosome 11 at 116,228,069 bp
  • T to C, chromosome 12 at 40,315,881 bp
  • T to A, chromosome 12 at 76,803,129 bp
  • A to G, chromosome 13 at 109,935,324 bp
  • G to A, chromosome 14 at 24,245,212 bp
  • C to A, chromosome 14 at 54,477,799 bp
  • G to T, chromosome 14 at 87,472,154 bp
  • A to G, chromosome 15 at 55,444,616 bp
  • G to A, chromosome 15 at 58,125,780 bp
  • C to T, chromosome 15 at 76,648,186 bp
  • A to G, chromosome 15 at 78,349,157 bp
  • T to A, chromosome 16 at 20,679,702 bp
  • G to T, chromosome 16 at 94,691,716 bp
  • C to A, chromosome 17 at 37,672,517 bp
  • T to A, chromosome 17 at 50,756,692 bp
  • T to G, chromosome 17 at 67,809,221 bp
  • C to A, chromosome 18 at 56,548,453 bp
  • T to C, chromosome 19 at 13,781,446 bp
  • T to C, chromosome 19 at 16,655,304 bp
  • T to A, chromosome 19 at 34,939,922 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7861 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045914-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.