Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7880Btlr/Mmmh
Stock Number:
045932-MU
Citation ID:
RRID:MMRRC_045932-MU
Other Names:
R7880 (G1)
Major Collection:

Strain Information

Trnt1
Name: tRNA nucleotidyl transferase, CCA-adding, 1
Synonyms: 2610044E04Rik, CGI-47, 2410043H24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70047
Homologene: 9333
Crabp1
Name: cellular retinoic acid binding protein I
Synonyms: Crabp-1, Rbp-5, CrabpI
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12903
HGNC: HGNC:2338
Homologene: 3222
Snapc3
Name: small nuclear RNA activating complex, polypeptide 3
Synonyms: 5031401C21Rik, 4930558A07Rik, 1810020H02Rik, E030018J20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77634
Homologene: 31130
Kansl1
Name: KAT8 regulatory NSL complex subunit 1
Synonyms: 1700081L11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76719
Homologene: 9140
Taf4
Name: TATA-box binding protein associated factor 4
Synonyms: Taf2c1, TAFII135, TAFII130, Taf4a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228980
Homologene: 55723
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 57,967,619 bp
  • A to T, chromosome 1 at 91,344,766 bp
  • A to C, chromosome 2 at 14,996,379 bp
  • A to G, chromosome 2 at 35,283,927 bp
  • G to T, chromosome 2 at 85,400,035 bp
  • T to A, chromosome 2 at 87,192,090 bp
  • A to T, chromosome 2 at 90,022,037 bp
  • A to G, chromosome 2 at 97,630,798 bp
  • C to A, chromosome 2 at 112,240,031 bp
  • T to A, chromosome 2 at 175,169,370 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • G to A, chromosome 2 at 179,935,933 bp
  • A to G, chromosome 3 at 101,007,866 bp
  • T to C, chromosome 4 at 14,703,946 bp
  • T to C, chromosome 4 at 83,435,194 bp
  • C to T, chromosome 4 at 88,401,170 bp
  • T to A, chromosome 4 at 89,688,844 bp
  • A to G, chromosome 4 at 140,157,508 bp
  • A to T, chromosome 4 at 145,181,114 bp
  • T to G, chromosome 5 at 98,872,575 bp
  • T to C, chromosome 6 at 29,170,156 bp
  • T to C, chromosome 6 at 54,817,347 bp
  • C to T, chromosome 6 at 90,325,080 bp
  • T to C, chromosome 6 at 106,769,556 bp
  • C to T, chromosome 6 at 119,349,155 bp
  • A to G, chromosome 7 at 6,132,191 bp
  • A to C, chromosome 7 at 26,673,134 bp
  • A to G, chromosome 7 at 75,586,216 bp
  • T to A, chromosome 7 at 133,909,962 bp
  • A to G, chromosome 8 at 26,978,690 bp
  • T to C, chromosome 8 at 85,305,244 bp
  • T to C, chromosome 8 at 125,464,393 bp
  • T to G, chromosome 9 at 18,944,728 bp
  • C to A, chromosome 9 at 54,765,658 bp
  • G to T, chromosome 9 at 66,508,224 bp
  • C to T, chromosome 10 at 10,546,415 bp
  • T to C, chromosome 10 at 18,136,954 bp
  • G to T, chromosome 10 at 72,657,092 bp
  • T to A, chromosome 10 at 91,166,030 bp
  • A to T, chromosome 11 at 23,649,369 bp
  • A to G, chromosome 11 at 69,331,464 bp
  • G to T, chromosome 11 at 104,424,153 bp
  • C to A, chromosome 13 at 34,746,819 bp
  • T to A, chromosome 15 at 32,686,808 bp
  • T to A, chromosome 15 at 91,246,105 bp
  • T to C, chromosome 16 at 33,719,509 bp
  • G to A, chromosome 16 at 38,602,725 bp
  • C to G, chromosome 16 at 43,992,076 bp
  • G to A, chromosome 16 at 85,798,052 bp
  • A to T, chromosome 17 at 20,776,410 bp
  • G to A, chromosome 17 at 29,261,788 bp
  • T to A, chromosome 17 at 36,127,869 bp
  • C to T, chromosome 18 at 22,522,151 bp
  • A to G, chromosome 18 at 43,986,326 bp
  • ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG to ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG, chromosome 18 at 80,089,825 bp
  • G to A, chromosome 19 at 8,742,328 bp
  • T to A, chromosome 19 at 55,206,280 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7880 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045932-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.