Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7880Btlr/Mmmh
Stock Number:
045932-MU
Citation ID:
RRID:MMRRC_045932-MU
Other Names:
R7880 (G1)
Major Collection:

Strain Information

Trnt1
Name: tRNA nucleotidyl transferase, CCA-adding, 1
Synonyms: 2610044E04Rik, CGI-47, 2410043H24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70047
Homologene: 9333
Crabp1
Name: cellular retinoic acid binding protein I
Synonyms: Crabp-1, Rbp-5, CrabpI
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12903
HGNC: HGNC:2338
Homologene: 3222
Snapc3
Name: small nuclear RNA activating complex, polypeptide 3
Synonyms: 5031401C21Rik, 4930558A07Rik, 1810020H02Rik, E030018J20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77634
Homologene: 31130
Kansl1
Name: KAT8 regulatory NSL complex subunit 1
Synonyms: 1700081L11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76719
Homologene: 9140
Taf4
Name: TATA-box binding protein associated factor 4
Synonyms: Taf2c1, TAFII130, TAFII135, Taf4a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228980
Homologene: 55723
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Orc6
Name: origin recognition complex, subunit 6
Synonyms: 6720420I10Rik, Orc6l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56452
Homologene: 8635
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230393
Homologene: 9842
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Zwint
Name: ZW10 interactor
Synonyms: 2600001N01Rik, 2010007E07Rik, D10Ertd749e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52696
Homologene: 48496
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Adam12
Name: ADAM metallopeptidase domain 12
Synonyms: Mltna, ADAM12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11489
HGNC: HGNC:190
Homologene: 74862
Gramd1c
Name: GRAM domain containing 1C
Synonyms: 4921521N14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207798
Homologene: 129735
Znrf2
Name: zinc and ring finger 2
Synonyms: 1190002C14Rik, D6Ertd365e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387524
Homologene: 15668
Ppil1
Name: peptidylprolyl isomerase (cyclophilin)-like 1
Synonyms: Cypl1, 1110060O10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68816
HGNC: HGNC:9260
Homologene: 9367
Nsun6
Name: NOL1/NOP2/Sun domain family member 6
Synonyms: 4933403D21Rik, NOPD1, 4933414E04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74455
Homologene: 12564
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Lrrc4c
Name: leucine rich repeat containing 4C
Synonyms: 6430556C10Rik, netrin g1 ligand, NGL-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241568
Homologene: 18696
Kcnab3
Name: potassium voltage-gated channel, shaker-related subfamily, beta member 3
Synonyms: mKv(beta)4, Kcnab4, C330022D06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16499
HGNC: HGNC:6230
Homologene: 55844
Spink5
Name: serine peptidase inhibitor, Kazal type 5
Synonyms: LEKT1, 2310065D10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72432
Homologene: 4987
Kctd18
Name: potassium channel tetramerisation domain containing 18
Synonyms: 4932411A20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 51960
Homologene: 12710
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Gucy2g
Name: guanylate cyclase 2g
Synonyms: 2410077I05Rik, GC-G
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73707
Homologene: 44544
Zfp787
Name: zinc finger protein 787
Synonyms: 2210018M03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67109
Homologene: 18983
Cd101
Name: CD101 antigen
Synonyms: LOC381460, Igsf2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 630146
HGNC: HGNC:5949
Homologene: 3142
Heg1
Name: heart development protein with EGF-like domains 1
Synonyms: LOC268884, 5530401I02Rik, 9530025L16Rik, 4632417D23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77446
Homologene: 35276
Dmrta1
Name: doublesex and mab-3 related transcription factor like family A1
Synonyms: Dmrt4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242523
Homologene: 18477
Vmn1r228
Name: vomeronasal 1 receptor 228
Synonyms: V1re3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171226
Homologene: 74320
Espnl
Name: espin-like
Synonyms: LOC227357
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227357
Homologene: 77795
Adamts1
Name: ADAM metallopeptidase with thrombospondin type 1 motif 1
Synonyms: ADAM-TS1, METH1, METH-1, ADAMTS-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11504
HGNC: HGNC:217
Homologene: 21381
Cyp2b23
Name: cytochrome P450, family 2, subfamily b, polypeptide 23
Synonyms: EG243881
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243881
HGNC: HGNC:2615
Homologene: 117483
Or5ak22
Name: olfactory receptor family 5 subfamily AK member 22
Synonyms: GA_x6K02T2Q125-46877170-46876241, MOR203-1, Olfr992
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258865
Homologene: 121517
Lpcat4
Name: lysophosphatidylcholine acyltransferase 4
Synonyms: Aytl3, Agpat7, LPEAT2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99010
Homologene: 27544
Tmpo
Name: thymopoietin
Synonyms: TP, 5630400D24Rik, LAP2, lamina-associated polypeptide 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21917
VEGA: 10
Homologene: 31144
Rab32
Name: RAB32, member RAS oncogene family
Synonyms: 2810011A17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67844
HGNC: HGNC:9772
Homologene: 38233
Bmp3
Name: bone morphogenetic protein 3
Synonyms: 9530029I04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 110075
HGNC: HGNC:1070
Homologene: 927
Cacna2d4
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms: 5730412N02Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319734
Homologene: 26544
Prrt4
Name: proline-rich transmembrane protein 4
Synonyms: D330027H18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101359
Homologene: 46116
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244668
Homologene: 18956
Sema5a
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
Synonyms: M-Sema D, semF, Semaf, 9130201M22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20356
VEGA: 15
Homologene: 2949
Arhgap31
Name: Rho GTPase activating protein 31
Synonyms: CdGAP
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12549
Homologene: 10644
Fam50b
Name: family with sequence similarity 50, member B
Synonyms: XAP-5-like, X5L, D0H6S2654E
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108161
VEGA: 13
Homologene: 101669
Redic1
Name: regulator of DNA class I crossover intermediates 1
Synonyms: Gm5807, CN725425
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545126
Pex13
Name: peroxisomal biogenesis factor 13
Synonyms: 2610008O20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72129
HGNC: HGNC:8855
Homologene: 1967
Or7g19
Name: olfactory receptor family 7 subfamily G member 19
Synonyms: GA_x6K02T2PVTD-12687800-12688738, MOR153-1, Olfr832
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258075
HGNC: HGNC:8467
Homologene: 128143
Stx5a
Name: syntaxin 5A
Synonyms: syntaxin 5, 0610031F24Rik, D19Ertd627e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56389
Homologene: 2381
Igsf21
Name: immunoglobulin superfamily, member 21
Synonyms: LOC230868
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230868
Homologene: 13153
Lrrc69
Name: leucine rich repeat containing 69
Synonyms: 1700034K16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73314
Homologene: 78018
Or12e1
Name: olfactory receptor family 12 subfamily E member 1
Synonyms: GA_x6K02T2Q125-48676316-48677272, MOR264-6, Olfr1112
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258655
Homologene: 64901
Zfp703
Name: zinc finger protein 703
Synonyms: 1110032O19Rik, Csmn1, End2, Zeppo1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 353310
Homologene: 81391
Or4c3
Name: olfactory receptor family 4 subfamily C member 3
Synonyms: GA_x6K02T2Q125-51454183-51453257, MOR236-1, Olfr1264
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258206
Homologene: 66365
Chst13
Name: carbohydrate sulfotransferase 13
Synonyms: Chst13, 1110067M19Rik, C4ST-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71797
Homologene: 44360
Gm21886
Name: predicted gene, 21886
Type: Gene
Species: Mouse
Chromosome: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 57,967,619 bp
  • A to T, chromosome 1 at 91,344,766 bp
  • A to C, chromosome 2 at 14,996,379 bp
  • A to G, chromosome 2 at 35,283,927 bp
  • G to T, chromosome 2 at 85,400,035 bp
  • T to A, chromosome 2 at 87,192,090 bp
  • A to T, chromosome 2 at 90,022,037 bp
  • A to G, chromosome 2 at 97,630,798 bp
  • C to A, chromosome 2 at 112,240,031 bp
  • T to A, chromosome 2 at 175,169,370 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • G to A, chromosome 2 at 179,935,933 bp
  • A to G, chromosome 3 at 101,007,866 bp
  • T to C, chromosome 4 at 14,703,946 bp
  • T to C, chromosome 4 at 83,435,194 bp
  • C to T, chromosome 4 at 88,401,170 bp
  • T to A, chromosome 4 at 89,688,844 bp
  • A to G, chromosome 4 at 140,157,508 bp
  • A to T, chromosome 4 at 145,181,114 bp
  • T to G, chromosome 5 at 98,872,575 bp
  • T to C, chromosome 6 at 29,170,156 bp
  • T to C, chromosome 6 at 54,817,347 bp
  • C to T, chromosome 6 at 90,325,080 bp
  • T to C, chromosome 6 at 106,769,556 bp
  • C to T, chromosome 6 at 119,349,155 bp
  • A to G, chromosome 7 at 6,132,191 bp
  • A to C, chromosome 7 at 26,673,134 bp
  • A to G, chromosome 7 at 75,586,216 bp
  • T to A, chromosome 7 at 133,909,962 bp
  • A to G, chromosome 8 at 26,978,690 bp
  • T to C, chromosome 8 at 85,305,244 bp
  • T to C, chromosome 8 at 125,464,393 bp
  • T to G, chromosome 9 at 18,944,728 bp
  • C to A, chromosome 9 at 54,765,658 bp
  • G to T, chromosome 9 at 66,508,224 bp
  • C to T, chromosome 10 at 10,546,415 bp
  • T to C, chromosome 10 at 18,136,954 bp
  • G to T, chromosome 10 at 72,657,092 bp
  • T to A, chromosome 10 at 91,166,030 bp
  • A to T, chromosome 11 at 23,649,369 bp
  • A to G, chromosome 11 at 69,331,464 bp
  • G to T, chromosome 11 at 104,424,153 bp
  • C to A, chromosome 13 at 34,746,819 bp
  • T to A, chromosome 15 at 32,686,808 bp
  • T to A, chromosome 15 at 91,246,105 bp
  • T to C, chromosome 16 at 33,719,509 bp
  • G to A, chromosome 16 at 38,602,725 bp
  • C to G, chromosome 16 at 43,992,076 bp
  • G to A, chromosome 16 at 85,798,052 bp
  • A to T, chromosome 17 at 20,776,410 bp
  • G to A, chromosome 17 at 29,261,788 bp
  • T to A, chromosome 17 at 36,127,869 bp
  • C to T, chromosome 18 at 22,522,151 bp
  • A to G, chromosome 18 at 43,986,326 bp
  • ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG to ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG, chromosome 18 at 80,089,825 bp
  • G to A, chromosome 19 at 8,742,328 bp
  • T to A, chromosome 19 at 55,206,280 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7880 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045932-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.