Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7881Btlr/Mmmh
Stock Number:
045933-MU
Citation ID:
RRID:MMRRC_045933-MU
Other Names:
R7881 (G1)
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, NP-2, 1110048P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Nrg1
Name: neuregulin 1
Synonyms: HGL, HRG, Hgl, SMDF, GGF, ARIA, heregulin, D230005F13Rik, HRGalpha, 6030402G23Rik, GGFII, NDF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Qtrt1
Name: queuine tRNA-ribosyltransferase catalytic subunit 1
Synonyms: Tgt, tRNA-guanine transglycosylase, 2610028E17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 60507
VEGA: 9
Homologene: 11061
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: D330022K21Rik, 2810449C13Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Mob2
Name: MOB kinase activator 2
Synonyms: 1110017M21Rik, 2700078K21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101513
Homologene: 12477
Gpbp1
Name: GC-rich promoter binding protein 1
Synonyms: 1700034P14Rik, D230035M11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73274
Homologene: 11292
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 3,216,264 bp
  • A to T, chromosome 1 at 18,128,669 bp
  • G to T, chromosome 1 at 21,369,675 bp
  • C to T, chromosome 1 at 36,407,036 bp
  • C to T, chromosome 1 at 39,386,023 bp
  • A to G, chromosome 1 at 62,771,831 bp
  • G to A, chromosome 1 at 87,995,713 bp
  • T to A, chromosome 2 at 32,402,231 bp
  • C to A, chromosome 2 at 86,041,470 bp
  • G to T, chromosome 2 at 87,108,057 bp
  • T to A, chromosome 2 at 110,292,526 bp
  • A to G, chromosome 2 at 174,120,594 bp
  • G to A, chromosome 3 at 76,536,298 bp
  • C to T, chromosome 4 at 42,851,586 bp
  • A to G, chromosome 4 at 117,110,388 bp
  • A to G, chromosome 4 at 130,816,933 bp
  • A to G, chromosome 4 at 137,633,455 bp
  • G to A, chromosome 4 at 148,444,269 bp
  • G to A, chromosome 4 at 151,835,876 bp
  • A to G, chromosome 5 at 123,152,273 bp
  • ACATCAGGATCC to ACATCAGGATCCCCATCAGGATCC, chromosome 6 at 4,756,454 bp
  • T to A, chromosome 6 at 15,409,889 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • T to A, chromosome 7 at 25,340,635 bp
  • A to G, chromosome 7 at 30,579,783 bp
  • A to T, chromosome 7 at 55,772,541 bp
  • G to T, chromosome 7 at 105,086,573 bp
  • G to C, chromosome 7 at 141,809,303 bp
  • T to C, chromosome 7 at 142,009,440 bp
  • T to G, chromosome 8 at 4,311,763 bp
  • G to A, chromosome 8 at 31,838,324 bp
  • C to A, chromosome 8 at 105,249,452 bp
  • A to G, chromosome 9 at 21,419,341 bp
  • T to A, chromosome 9 at 38,254,110 bp
  • T to C, chromosome 9 at 51,149,114 bp
  • C to A, chromosome 9 at 97,363,017 bp
  • T to C, chromosome 9 at 106,080,298 bp
  • G to A, chromosome 9 at 108,828,072 bp
  • A to G, chromosome 10 at 53,698,493 bp
  • A to G, chromosome 10 at 62,449,524 bp
  • A to T, chromosome 10 at 79,478,427 bp
  • T to C, chromosome 10 at 81,346,608 bp
  • G to T, chromosome 10 at 88,324,747 bp
  • T to A, chromosome 10 at 90,967,018 bp
  • G to A, chromosome 11 at 5,444,533 bp
  • A to G, chromosome 11 at 33,633,206 bp
  • T to C, chromosome 11 at 69,431,238 bp
  • T to A, chromosome 11 at 95,750,109 bp
  • C to T, chromosome 12 at 117,987,502 bp
  • A to G, chromosome 13 at 49,790,071 bp
  • A to G, chromosome 13 at 77,323,566 bp
  • A to T, chromosome 13 at 111,439,199 bp
  • A to T, chromosome 14 at 34,267,767 bp
  • A to G, chromosome 14 at 50,653,447 bp
  • T to C, chromosome 14 at 50,793,820 bp
  • C to T, chromosome 15 at 63,897,719 bp
  • T to C, chromosome 15 at 81,780,478 bp
  • G to A, chromosome 16 at 45,582,969 bp
  • T to C, chromosome 16 at 73,920,697 bp
  • A to T, chromosome 17 at 12,748,704 bp
  • A to G, chromosome 17 at 17,566,739 bp
  • T to C, chromosome 17 at 23,191,466 bp
  • G to T, chromosome 17 at 37,805,429 bp
  • C to T, chromosome 17 at 50,047,435 bp
  • C to A, chromosome 17 at 74,641,671 bp
  • T to A, chromosome 17 at 86,922,300 bp
  • T to A, chromosome 18 at 49,864,383 bp
  • A to T, chromosome 19 at 5,651,676 bp
  • T to C, chromosome 19 at 5,719,398 bp
  • G to A, chromosome 19 at 17,123,029 bp
  • G to A, chromosome 19 at 27,396,328 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7881 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045933-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.