Strain Name:
C57BL/6J-MtgxR7881Btlr/Mmmh
Stock Number:
045933-MU
Citation ID:
RRID:MMRRC_045933-MU
Other Names:
R7881 (G1)
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: Npn2, NP-2, 1110048P06Rik, NP2, Npn-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Nrg1
Name: neuregulin 1
Synonyms: GGFII, HGL, Hgl, SMDF, GGF, HRG, D230005F13Rik, ARIA, HRGalpha, heregulin, 6030402G23Rik, NDF
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211323
HGNC: HGNC:7997
Homologene: 138451
Qtrt1
Name: queuine tRNA-ribosyltransferase catalytic subunit 1
Synonyms: tRNA-guanine transglycosylase, Tgt, 2610028E17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 60507
VEGA: 9
Homologene: 11061
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: 2810449C13Rik, D330022K21Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Mob2
Name: MOB kinase activator 2
Synonyms: 2700078K21Rik, 1110017M21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101513
Homologene: 12477
Gpbp1
Name: GC-rich promoter binding protein 1
Synonyms: 1700034P14Rik, D230035M11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73274
Homologene: 11292
Zc3h7b
Name: zinc finger CCCH type containing 7B
Synonyms: Scrg3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20286
VEGA: 15
Homologene: 9735
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: D630005A10Rik, apollon, A430032G04Rik, A430040A19Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Tbc1d8
Name: TBC1 domain family, member 8
Synonyms: BUB2-like protein 1, GRAM domain, HBLP1, AD3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54610
Homologene: 31421
Hmg20b
Name: high mobility group 20B
Synonyms: Hmgx2, BRAF35, Smarce1r, BRCA2-associated factor 35, Hmgxb2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15353
HGNC: HGNC:5002
Homologene: 74949
Robo2
Name: roundabout guidance receptor 2
Synonyms: D230004I22Rik, 2600013A04Rik, 9430089E08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268902
Homologene: 43188
Ptges2
Name: prostaglandin E synthase 2
Synonyms: GBF-1, GBF1, 0610038H10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 96979
Homologene: 11819
Camta1
Name: calmodulin binding transcription activator 1
Synonyms: 1810059M14Rik, 2310058O09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100072
Homologene: 18942
Shld2
Name: shieldin complex subunit 2
Synonyms: Fam35a, 3110001K24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75698
VEGA: 14
Homologene: 56840
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, Olfaxin, A230083H22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: M6P/IGF2R, mannose-6-phosphate receptor, cation independent, CD222, CI-MPR, Mpr300, IGF-II/CI-MPR
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Pum3
Name: pumilio RNA-binding family member 3
Synonyms: 1110069H02Rik, D19Bwg1357e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52874
VEGA: 19
Homologene: 5762
Elavl1
Name: ELAV like RNA binding protein 1
Synonyms: HuR, ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R), Hua, W91709, 2410055N02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15568
HGNC: HGNC:3312
Homologene: 20367
Lnpep
Name: leucyl/cystinyl aminopeptidase
Synonyms: 2010309L07Rik, vp165, IRAP, 4732490P18Rik, gp160
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240028
VEGA: 17
HGNC: HGNC:6656
Homologene: 21148
Phaf1
Name: phagosome assembly factor 1
Synonyms: Lin10, D230025D16Rik, Mytho
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234678
Homologene: 11864
Znrf3
Name: zinc and ring finger 3
Synonyms: LOC382477
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 407821
Homologene: 46592
Sdc3
Name: syndecan 3
Synonyms: syn-3, Synd3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20970
Homologene: 7965
Siglech
Name: sialic acid binding Ig-like lectin H
Synonyms: Siglec-H, 6430529G09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233274
Homologene: 48041
Peg10
Name: paternally expressed 10
Synonyms: HB-1, Edr, MyEF-3 like, MEF3L, Mart2, Rtl2, MyEF-3, Mar2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Foxp2
Name: forkhead box P2
Synonyms: D0Kist7, 2810043D05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 114142
Homologene: 134404
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: Dnahc2, D330014H01Rik, Dnhd3, 2900022L05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Setd1b
Name: SET domain containing 1B
Synonyms: KMT2G
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208043
Homologene: 134654
Fstl5
Name: follistatin-like 5
Synonyms: 9130207J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213262
Homologene: 10584
Slc9c1
Name: solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms: LOC208169, spermNHE, Slc9a10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208169
Homologene: 19505
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: b2b1203Clo, Dnahc11, avc4, b2b1289Clo, b2b1279Clo, lrd, b2b598Clo, b2b1727Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Usp40
Name: ubiquitin specific peptidase 40
Synonyms: B230215L03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227334
Homologene: 32400
Zfp652
Name: zinc finger protein 652
Synonyms: 9530033F24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268469
Homologene: 54768
Bbox1
Name: gamma-butyrobetaine hydroxylase 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170442
HGNC: HGNC:964
Homologene: 2967
Kmt2b
Name: lysine (K)-specific methyltransferase 2B
Synonyms: Mll2, Wbp7, 2610014H22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75410
Homologene: 22838
Or2b4
Name: olfactory receptor family 2 subfamily B member 4
Synonyms: GA_x6K02T2PSCP-2264806-2265753, MOR256-3, Olfr124, SR1, A3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 259064
Homologene: 74266
Ccnb1ip1
Name: cyclin B1 interacting protein 1
Synonyms: LOC239083, mei4, Hei10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239083
VEGA: 14
Homologene: 18819
Megf8
Name: multiple EGF-like-domains 8
Synonyms: b2b288Clo, b2b1702Clo, m687Ddg, Egfl4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Or56a3
Name: olfactory receptor family 56 subfamily A member 3
Synonyms: Olfr679, MOR40-2, GA_x6K02T2PBJ9-7714499-7715446
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259046
Homologene: 81538
Npepl1
Name: aminopeptidase-like 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228961
Homologene: 11647
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: Dvwa, EG235580, Vwa6, 1110001D15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Vmn2r83
Name: vomeronasal 2, receptor 83
Synonyms: EG625029
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625029
Homologene: 83669
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Adgrc3, flamingo, Fmi1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Trim42
Name: tripartite motif-containing 42
Synonyms: 4930486B16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78911
Homologene: 12712
Tmem247
Name: transmembrane protein 247
Synonyms: 1700090G07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78469
Homologene: 54379
Kcnip1
Name: Kv channel-interacting protein 1
Synonyms: KCHIP1, 2900046L02Rik, 3202002F18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70357
Homologene: 22824
Xkr4
Name: X-linked Kx blood group related 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 497097
Homologene: 45848
Or11h7
Name: olfactory receptor family 11 subfamily H member 7
Synonyms: GA_x6K02T2PMLR-6372116-6373060, MOR106-12, Olfr746
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258295
Homologene: 134081
2210408I21Rik
Name: RIKEN cDNA 2210408I21 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72371
Homologene: 89234
Sipa1
Name: signal-induced proliferation associated gene 1
Synonyms: SPA-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20469
VEGA: 19
Homologene: 7940
Spata31f1a
Name: spermatogenesis associated 31 subfamily F member 1A
Synonyms: Fam205a1, Gm12429
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433698
Homologene: 79022
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Or8c8
Name: olfactory receptor family 8 subfamily C member 8
Synonyms: K18, GA_x6K02T2PVTD-31941084-31942025, MOR170-6, Olfr143
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258802
Homologene: 133627
Fam184a
Name: family with sequence similarity 184, member A
Synonyms: 4930589M24Rik, 3110012E06Rik, 4930438C08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75906
Homologene: 11600
Rftn1
Name: raftlin lipid raft linker 1
Synonyms: 2310015N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76438
Homologene: 18745
Or5m3b
Name: olfactory receptor family 5 subfamily M member 3B
Synonyms: MOR199-2, Olfr1033, GA_x6K02T2Q125-47516301-47517233
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258571
Homologene: 138314
Gsdmc4
Name: gasdermin C4
Synonyms: 9030605I04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74548
HGNC: HGNC:7151
Homologene: 69487
Khdc1c
Name: KH domain containing 1C
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 433278
Homologene: 134524
Anks1b
Name: ankyrin repeat and sterile alpha motif domain containing 1B
Synonyms: AIDA-1b, LOC380650, E530015N03Rik, Gm10937, C030032C09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77531
Homologene: 51570
Dram1
Name: DNA-damage regulated autophagy modulator 1
Synonyms: 1200002N14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71712
Homologene: 41255
Crisp4
Name: cysteine-rich secretory protein 4
Synonyms: 9230112K08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78081
HGNC: HGNC:304
Homologene: 81683
Zfp40
Name: zinc finger protein 40
Synonyms: NTfin12, Zfp-40
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22700
Homologene: 136312
Ubiad1
Name: UbiA prenyltransferase domain containing 1
Synonyms: Tere1, 1200002M06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71707
Homologene: 8336
Or5aq7
Name: olfactory receptor family 5 subfamily AQ member 7
Synonyms: Olfr259, GA_x6K02T2N869-1820-882, MOR172-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258766
Homologene: 106833
Fer1l5
Name: fer-1 like family member 5
Synonyms: 4930533C12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100534273
Homologene: 85232
Gm32742
Name: predicted gene, 32742
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102635385
Homologene: 132734
4930507D05Rik
Name: RIKEN cDNA 4930507D05 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74706
VEGA: 10
Spata31e1
Name: spermatogenesis associated 31 subfamily E member 1
Synonyms: Gm30302
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 102632152
VEGA: 13
Homologene: 141176
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 3,216,264 bp
  • A to T, chromosome 1 at 18,128,669 bp
  • G to T, chromosome 1 at 21,369,675 bp
  • C to T, chromosome 1 at 36,407,036 bp
  • C to T, chromosome 1 at 39,386,023 bp
  • A to G, chromosome 1 at 62,771,831 bp
  • G to A, chromosome 1 at 87,995,713 bp
  • T to A, chromosome 2 at 32,402,231 bp
  • C to A, chromosome 2 at 86,041,470 bp
  • G to T, chromosome 2 at 87,108,057 bp
  • T to A, chromosome 2 at 110,292,526 bp
  • A to G, chromosome 2 at 174,120,594 bp
  • G to A, chromosome 3 at 76,536,298 bp
  • C to T, chromosome 4 at 42,851,586 bp
  • A to G, chromosome 4 at 117,110,388 bp
  • A to G, chromosome 4 at 130,816,933 bp
  • A to G, chromosome 4 at 137,633,455 bp
  • G to A, chromosome 4 at 148,444,269 bp
  • G to A, chromosome 4 at 151,835,876 bp
  • A to G, chromosome 5 at 123,152,273 bp
  • ACATCAGGATCC to ACATCAGGATCCCCATCAGGATCC, chromosome 6 at 4,756,454 bp
  • T to A, chromosome 6 at 15,409,889 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • T to A, chromosome 7 at 25,340,635 bp
  • A to G, chromosome 7 at 30,579,783 bp
  • A to T, chromosome 7 at 55,772,541 bp
  • G to T, chromosome 7 at 105,086,573 bp
  • G to C, chromosome 7 at 141,809,303 bp
  • T to C, chromosome 7 at 142,009,440 bp
  • T to G, chromosome 8 at 4,311,763 bp
  • G to A, chromosome 8 at 31,838,324 bp
  • C to A, chromosome 8 at 105,249,452 bp
  • A to G, chromosome 9 at 21,419,341 bp
  • T to A, chromosome 9 at 38,254,110 bp
  • T to C, chromosome 9 at 51,149,114 bp
  • C to A, chromosome 9 at 97,363,017 bp
  • T to C, chromosome 9 at 106,080,298 bp
  • G to A, chromosome 9 at 108,828,072 bp
  • A to G, chromosome 10 at 53,698,493 bp
  • A to G, chromosome 10 at 62,449,524 bp
  • A to T, chromosome 10 at 79,478,427 bp
  • T to C, chromosome 10 at 81,346,608 bp
  • G to T, chromosome 10 at 88,324,747 bp
  • T to A, chromosome 10 at 90,967,018 bp
  • G to A, chromosome 11 at 5,444,533 bp
  • A to G, chromosome 11 at 33,633,206 bp
  • T to C, chromosome 11 at 69,431,238 bp
  • T to A, chromosome 11 at 95,750,109 bp
  • C to T, chromosome 12 at 117,987,502 bp
  • A to G, chromosome 13 at 49,790,071 bp
  • A to G, chromosome 13 at 77,323,566 bp
  • A to T, chromosome 13 at 111,439,199 bp
  • A to T, chromosome 14 at 34,267,767 bp
  • A to G, chromosome 14 at 50,653,447 bp
  • T to C, chromosome 14 at 50,793,820 bp
  • C to T, chromosome 15 at 63,897,719 bp
  • T to C, chromosome 15 at 81,780,478 bp
  • G to A, chromosome 16 at 45,582,969 bp
  • T to C, chromosome 16 at 73,920,697 bp
  • A to T, chromosome 17 at 12,748,704 bp
  • A to G, chromosome 17 at 17,566,739 bp
  • T to C, chromosome 17 at 23,191,466 bp
  • G to T, chromosome 17 at 37,805,429 bp
  • C to T, chromosome 17 at 50,047,435 bp
  • C to A, chromosome 17 at 74,641,671 bp
  • T to A, chromosome 17 at 86,922,300 bp
  • T to A, chromosome 18 at 49,864,383 bp
  • A to T, chromosome 19 at 5,651,676 bp
  • T to C, chromosome 19 at 5,719,398 bp
  • G to A, chromosome 19 at 17,123,029 bp
  • G to A, chromosome 19 at 27,396,328 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7881 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045933-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.