Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7887Btlr/Mmmh
Stock Number:
045939-MU
Citation ID:
RRID:MMRRC_045939-MU
Other Names:
R7887 (G1)
Major Collection:

Strain Information

Prkaca
Name: protein kinase, cAMP dependent, catalytic, alpha
Synonyms: Cs, C alpha, PKA, Pkaca
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18747
HGNC: HGNC:9380
Homologene: 121574
Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: C78091, Unrip
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20901
Homologene: 43881
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
B4galt1
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms: Ggtb, Ggtb2, B-1,4-GalT1, beta-1,4-GalT1, GalT, beta 1,4-Galactosyltransferase I, b1,4-Galactosyltransferase I
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14595
HGNC: HGNC:924
Homologene: 20378
Gpr26
Name: G protein-coupled receptor 26
Synonyms: 9630036A11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233919
HGNC: HGNC:4481
Homologene: 17764
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Alkbh8
Name: alkB homolog 8, tRNA methyltransferase
Synonyms: 8030431D03Rik, 9430088N01Rik, 4930562C03Rik, Abh8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67667
Homologene: 44488
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,208,034 bp
  • T to C, chromosome 1 at 83,277,412 bp
  • G to A, chromosome 1 at 91,300,641 bp
  • C to A, chromosome 1 at 125,677,542 bp
  • C to T, chromosome 1 at 175,785,545 bp
  • G to A, chromosome 1 at 193,167,732 bp
  • C to A, chromosome 2 at 25,264,012 bp
  • A to G, chromosome 2 at 31,020,894 bp
  • T to C, chromosome 2 at 87,949,880 bp
  • A to C, chromosome 2 at 130,281,758 bp
  • C to T, chromosome 3 at 37,412,380 bp
  • C to T, chromosome 3 at 96,684,900 bp
  • A to G, chromosome 4 at 40,823,501 bp
  • C to T, chromosome 4 at 65,644,866 bp
  • T to G, chromosome 4 at 88,182,616 bp
  • A to G, chromosome 4 at 131,860,866 bp
  • T to C, chromosome 4 at 139,407,810 bp
  • GTCTAT to GTCTATTCTAT, chromosome 5 at 14,714,190 bp
  • T to C, chromosome 5 at 107,359,933 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • C to T, chromosome 5 at 113,961,349 bp
  • C to T, chromosome 5 at 120,627,203 bp
  • G to T, chromosome 5 at 130,037,870 bp
  • T to C, chromosome 5 at 147,019,043 bp
  • T to A, chromosome 6 at 38,636,571 bp
  • T to G, chromosome 6 at 137,739,809 bp
  • T to C, chromosome 7 at 3,694,708 bp
  • T to C, chromosome 7 at 19,034,439 bp
  • T to C, chromosome 7 at 100,029,250 bp
  • A to C, chromosome 7 at 102,942,151 bp
  • A to C, chromosome 7 at 131,966,973 bp
  • A to T, chromosome 8 at 60,941,399 bp
  • T to C, chromosome 8 at 83,986,895 bp
  • T to A, chromosome 9 at 3,385,343 bp
  • A to T, chromosome 9 at 39,364,879 bp
  • A to T, chromosome 9 at 105,032,791 bp
  • A to G, chromosome 9 at 109,649,594 bp
  • C to T, chromosome 10 at 77,706,945 bp
  • T to A, chromosome 12 at 73,188,191 bp
  • G to T, chromosome 13 at 13,499,733 bp
  • A to T, chromosome 13 at 22,474,786 bp
  • T to A, chromosome 13 at 47,239,811 bp
  • T to C, chromosome 14 at 26,599,657 bp
  • C to T, chromosome 14 at 31,176,695 bp
  • C to T, chromosome 14 at 31,634,227 bp
  • T to A, chromosome 14 at 32,217,662 bp
  • C to T, chromosome 14 at 54,983,662 bp
  • A to G, chromosome 14 at 59,359,580 bp
  • A to G, chromosome 14 at 70,079,202 bp
  • G to A, chromosome 17 at 56,011,097 bp
  • T to A, chromosome 18 at 64,340,975 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7887 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045939-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.