Strain Name:
C57BL/6J-MtgxR7887Btlr/Mmmh
Stock Number:
045939-MU
Citation ID:
RRID:MMRRC_045939-MU
Other Names:
R7887 (G1)
Major Collection:

Strain Information

Prkaca
Name: protein kinase, cAMP dependent, catalytic, alpha
Synonyms: PKA, Pkaca, Cs, C alpha
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18747
HGNC: HGNC:9380
Homologene: 121574
Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: Unrip, C78091
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20901
Homologene: 43881
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: MyHC-I, Myhcb, MYH-beta/slow, Myhc-b, betaMHC, beta-MHC, B-MHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
B4galt1
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms: Ggtb2, Ggtb, beta 1,4-Galactosyltransferase I, b1,4-Galactosyltransferase I, GalT, B-1,4-GalT1, beta-1,4-GalT1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14595
HGNC: HGNC:924
Homologene: 20378
Gpr26
Name: G protein-coupled receptor 26
Synonyms: 9630036A11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233919
HGNC: HGNC:4481
Homologene: 17764
Nisch
Name: nischarin
Synonyms: edsn, 3202002H23Rik, 1200007D05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Alkbh8
Name: alkB homolog 8, tRNA methyltransferase
Synonyms: Abh8, 8030431D03Rik, 4930562C03Rik, 9430088N01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67667
Homologene: 44488
Ddx54
Name: DEAD box helicase 54
Synonyms: DP97, DEAD (Asp-Glu-Ala-Asp) box polypeptide 54, 2410015A15Rik, APR-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71990
Homologene: 5590
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230393
Homologene: 9842
Parg
Name: poly (ADP-ribose) glycohydrolase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26430
HGNC: HGNC:8605
Homologene: 50532
Mnat1
Name: menage a trois 1
Synonyms: MAT1, E130115E11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17420
HGNC: HGNC:7181
Homologene: 1821
Phf11d
Name: PHD finger protein 11D
Synonyms: D14Ertd668e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219132
Homologene: 87807
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: Zubr1, 1810009A16Rik, D930005K06Rik, LOC381562, p600, A930005E13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Chrdl2
Name: chordin-like 2
Synonyms: Chl2, 1810022C01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69121
Homologene: 128795
Crcp
Name: calcitonin gene-related peptide-receptor component protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12909
Homologene: 40587
Sympk
Name: symplekin
Synonyms: 1500016F02Rik, 4632415H16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68188
Homologene: 37969
Dennd6a
Name: DENN domain containing 6A
Synonyms: Fam116a, A630054L15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211922
Homologene: 13503
Uggt1
Name: UDP-glucose glycoprotein glucosyltransferase 1
Synonyms: Ugcgl1, A930007H10Rik, 0910001L17Rik, C820010P03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320011
Homologene: 10586
Ssh1
Name: slingshot protein phosphatase 1
Synonyms: mSSH-1L, LOC384311
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231637
Homologene: 41299
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Pico, Acz
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Ankrd35
Name: ankyrin repeat domain 35
Synonyms: 4732436F15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213121
Homologene: 16977
Clcn3
Name: chloride channel, voltage-sensitive 3
Synonyms: Clc3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12725
HGNC: HGNC:2021
Homologene: 20435
Astn2
Name: astrotactin 2
Synonyms: 1d8, Astnl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56079
Homologene: 77850
Wdr64
Name: WD repeat domain 64
Synonyms: 4930511H01Rik, 4930415O10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Lnx2
Name: ligand of numb-protein X 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140887
Homologene: 17737
Irf6
Name: interferon regulatory factor 6
Synonyms: E230028I05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54139
HGNC: HGNC:6121
Homologene: 4479
Idh3b
Name: isocitrate dehydrogenase 3 (NAD+) beta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170718
HGNC: HGNC:5385
Homologene: 5035
Gpr39
Name: G protein-coupled receptor 39
Synonyms: 4933415E13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71111
HGNC: HGNC:4496
Homologene: 20380
Usp20
Name: ubiquitin specific peptidase 20
Synonyms: 1700055M05Rik, Vdu2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74270
Homologene: 4861
Onecut2
Name: one cut domain, family member 2
Synonyms: Oc2, OC-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225631
HGNC: HGNC:8139
Homologene: 113592
Vmn1r201
Name: vomeronasal 1 receptor 201
Synonyms: V1ri4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171255
Homologene: 110880
Or5l13
Name: olfactory receptor family 5 subfamily L member 13
Synonyms: GA_x6K02T2Q125-49433499-49432537, Olfr1156, MOR174-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258814
HGNC: HGNC:8351
Homologene: 72031
Sphkap
Name: SPHK1 interactor, AKAP domain containing
Synonyms: SKIP, 4930544G21Rik, A930009L15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77629
Homologene: 18172
Nid1
Name: nidogen 1
Synonyms: entactin-1, nidogen-1, entactin 1, entactin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl1, Psgl-1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Rnf144b
Name: ring finger protein 144B
Synonyms: Ibrdc2, E130105P19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218215
VEGA: 13
Homologene: 27092
Cpne4
Name: copine IV
Synonyms: 4933406O10Rik, 3632411M23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74020
HGNC: HGNC:2317
Homologene: 26078
Or51h7
Name: olfactory receptor family 51 subfamily H member 7
Synonyms: MOR10-4, GA_x6K02T2PBJ9-5653743-5652872, MOR10-3P, Olfr573
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258230
Hacl1
Name: 2-hydroxyacyl-CoA lyase 1
Synonyms: 1600020H07Rik, Hpcl, Phyh2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56794
Homologene: 5794
Tprn
Name: taperin
Synonyms: C430004E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 97031
Homologene: 52156
Brdt
Name: bromodomain, testis-specific
Synonyms: 7420412D09Rik, Fsrg3, Brd6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114642
HGNC: HGNC:1105
Homologene: 21064
Scly
Name: selenocysteine lyase
Synonyms: Scly1, Scly2, Selenocysteine reductase, SCL, A930015N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 50880
Homologene: 9548
Krtap12-23
Name: keratin associated protein 12-23
Synonyms: Gm10272
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16697
VEGA: 10
Nudt6
Name: nudix hydrolase 6
Synonyms: nudix (nucleoside diphosphate linked moiety X)-type motif 6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229228
HGNC: HGNC:8053
Homologene: 31425
Klrg2
Name: killer cell lectin-like receptor subfamily G, member 2
Synonyms: 2310020F24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74253
Homologene: 52362
Tsen34
Name: tRNA splicing endonuclease subunit 34
Synonyms: 0610027F08Rik, Leng5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66078
Homologene: 44182
Mecr
Name: mitochondrial trans-2-enoyl-CoA reductase
Synonyms: Nrbf1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26922
Homologene: 5362
Mpnd
Name: MPN domain containing
Synonyms: E130307M08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68047
Homologene: 12231
Egr3
Name: early growth response 3
Synonyms: Pilot
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13655
VEGA: 14
HGNC: HGNC:3240
Homologene: 37923
Fbxw25
Name: F-box and WD-40 domain protein 25
Synonyms: E330001B16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546160
Or8g31-ps1
Name: olfactory receptor family 8 subfamily G member 31, pseudogene 1
Synonyms: Olfr949-ps1, MOR171-26P, GA_x6K02T2PVTD-33061144-33062101
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258194
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,208,034 bp
  • T to C, chromosome 1 at 83,277,412 bp
  • G to A, chromosome 1 at 91,300,641 bp
  • C to A, chromosome 1 at 125,677,542 bp
  • C to T, chromosome 1 at 175,785,545 bp
  • G to A, chromosome 1 at 193,167,732 bp
  • C to A, chromosome 2 at 25,264,012 bp
  • A to G, chromosome 2 at 31,020,894 bp
  • T to C, chromosome 2 at 87,949,880 bp
  • A to C, chromosome 2 at 130,281,758 bp
  • C to T, chromosome 3 at 37,412,380 bp
  • C to T, chromosome 3 at 96,684,900 bp
  • A to G, chromosome 4 at 40,823,501 bp
  • C to T, chromosome 4 at 65,644,866 bp
  • T to G, chromosome 4 at 88,182,616 bp
  • A to G, chromosome 4 at 131,860,866 bp
  • T to C, chromosome 4 at 139,407,810 bp
  • GTCTAT to GTCTATTCTAT, chromosome 5 at 14,714,190 bp
  • T to C, chromosome 5 at 107,359,933 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • C to T, chromosome 5 at 113,961,349 bp
  • C to T, chromosome 5 at 120,627,203 bp
  • G to T, chromosome 5 at 130,037,870 bp
  • T to C, chromosome 5 at 147,019,043 bp
  • T to A, chromosome 6 at 38,636,571 bp
  • T to G, chromosome 6 at 137,739,809 bp
  • T to C, chromosome 7 at 3,694,708 bp
  • T to C, chromosome 7 at 19,034,439 bp
  • T to C, chromosome 7 at 100,029,250 bp
  • A to C, chromosome 7 at 102,942,151 bp
  • A to C, chromosome 7 at 131,966,973 bp
  • A to T, chromosome 8 at 60,941,399 bp
  • T to C, chromosome 8 at 83,986,895 bp
  • T to A, chromosome 9 at 3,385,343 bp
  • A to T, chromosome 9 at 39,364,879 bp
  • A to T, chromosome 9 at 105,032,791 bp
  • A to G, chromosome 9 at 109,649,594 bp
  • C to T, chromosome 10 at 77,706,945 bp
  • T to A, chromosome 12 at 73,188,191 bp
  • G to T, chromosome 13 at 13,499,733 bp
  • A to T, chromosome 13 at 22,474,786 bp
  • T to A, chromosome 13 at 47,239,811 bp
  • T to C, chromosome 14 at 26,599,657 bp
  • C to T, chromosome 14 at 31,176,695 bp
  • C to T, chromosome 14 at 31,634,227 bp
  • T to A, chromosome 14 at 32,217,662 bp
  • C to T, chromosome 14 at 54,983,662 bp
  • A to G, chromosome 14 at 59,359,580 bp
  • A to G, chromosome 14 at 70,079,202 bp
  • G to A, chromosome 17 at 56,011,097 bp
  • T to A, chromosome 18 at 64,340,975 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7887 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045939-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.