MMRRC:045947-MU

T to A, chromosome 1 at 12,989,703 bp
T to C, chromosome 1 at 17,161,144 bp
T to C, chromosome 1 at 34,806,397 bp
A to C, chromosome 1 at 36,553,118 bp
T to C, chromosome 1 at 46,249,950 bp
T to A, chromosome 1 at 74,933,162 bp
C to T, chromosome 1 at 75,278,202 bp
A to T, chromosome 1 at 161,845,368 bp
A to G, chromosome 1 at 175,900,996 bp
A to G, chromosome 2 at 67,509,497 bp
T to C, chromosome 2 at 69,458,479 bp
G to A, chromosome 2 at 70,684,098 bp
T to A, chromosome 2 at 144,253,820 bp
A to G, chromosome 3 at 5,242,199 bp
G to T, chromosome 3 at 51,697,722 bp
A to G, chromosome 3 at 64,089,709 bp
C to T, chromosome 3 at 107,669,151 bp
A to T, chromosome 3 at 129,995,949 bp
A to G, chromosome 3 at 144,968,405 bp
T to C, chromosome 4 at 43,890,970 bp
T to A, chromosome 4 at 48,051,390 bp
C to T, chromosome 4 at 85,063,324 bp
A to T, chromosome 4 at 119,352,713 bp
A to T, chromosome 4 at 144,670,343 bp
A to G, chromosome 4 at 155,862,548 bp
A to C, chromosome 5 at 23,800,722 bp
A to G, chromosome 5 at 25,373,176 bp
C to T, chromosome 5 at 136,748,177 bp
T to A, chromosome 5 at 142,470,558 bp
A to T, chromosome 6 at 91,987,281 bp
G to A, chromosome 6 at 126,102,240 bp
A to G, chromosome 7 at 7,295,168 bp
T to A, chromosome 7 at 12,837,093 bp
A to T, chromosome 7 at 18,942,345 bp
A to T, chromosome 7 at 24,888,339 bp
A to T, chromosome 7 at 84,305,198 bp
T to A, chromosome 7 at 107,721,317 bp
T to C, chromosome 7 at 125,672,822 bp
T to A, chromosome 7 at 131,555,871 bp
C to A, chromosome 7 at 141,259,375 bp
ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
C to A, chromosome 8 at 46,562,464 bp
C to A, chromosome 8 at 94,081,136 bp
A to G, chromosome 8 at 105,363,366 bp
A to T, chromosome 8 at 105,664,058 bp
T to A, chromosome 8 at 112,752,197 bp
G to A, chromosome 9 at 8,655,218 bp
T to A, chromosome 9 at 64,179,332 bp
A to T, chromosome 9 at 108,050,571 bp
A to G, chromosome 9 at 113,903,948 bp
T to A, chromosome 10 at 39,088,329 bp
T to A, chromosome 10 at 59,181,049 bp
C to A, chromosome 10 at 60,779,730 bp
T to A, chromosome 10 at 78,283,200 bp
C to A, chromosome 10 at 79,541,885 bp
A to T, chromosome 11 at 33,156,001 bp
T to A, chromosome 11 at 76,945,895 bp
G to C, chromosome 11 at 77,454,626 bp
T to C, chromosome 11 at 89,040,856 bp
A to C, chromosome 11 at 105,117,324 bp
T to A, chromosome 11 at 105,921,825 bp
A to T, chromosome 12 at 8,011,933 bp
A to T, chromosome 12 at 24,044,723 bp
A to T, chromosome 12 at 55,059,510 bp
A to G, chromosome 12 at 55,747,149 bp
G to A, chromosome 12 at 70,255,187 bp
A to T, chromosome 12 at 72,652,460 bp
A to G, chromosome 12 at 84,419,989 bp
T to G, chromosome 12 at 110,616,457 bp
G to T, chromosome 12 at 117,873,732 bp
G to T, chromosome 13 at 18,125,448 bp
G to A, chromosome 14 at 52,581,093 bp
T to A, chromosome 14 at 57,602,591 bp
A to G, chromosome 14 at 64,736,149 bp
A to T, chromosome 15 at 82,177,240 bp
A to T, chromosome 15 at 82,285,819 bp
G to A, chromosome 16 at 19,566,722 bp
A to T, chromosome 16 at 44,216,202 bp
T to A, chromosome 16 at 91,025,278 bp
T to G, chromosome 17 at 14,676,221 bp
C to T, chromosome 17 at 15,063,613 bp
T to C, chromosome 17 at 21,287,466 bp
A to T, chromosome 17 at 25,937,325 bp
T to C, chromosome 17 at 35,044,379 bp
T to C, chromosome 17 at 71,273,913 bp
C to T, chromosome 17 at 80,373,485 bp
T to G, chromosome 17 at 81,441,899 bp
T to A, chromosome 18 at 37,490,467 bp
A to G, chromosome 19 at 3,964,871 bp
A to T, chromosome 19 at 5,100,496 bp
A to G, chromosome 19 at 5,652,662 bp
A to T, chromosome 19 at 10,979,330 bp
T to G, chromosome 19 at 56,354,152 bp

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R7895 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
045947-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All