Strain Name:
C57BL/6J-MtgxR7895Btlr/Mmmh
Stock Number:
045947-MU
Citation ID:
RRID:MMRRC_045947-MU
Other Names:
R7895 (G1)
Major Collection:

Strain Information

Ntf3
Name: neurotrophin 3
Synonyms: NT-3, Ntf-3, NT3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18205
HGNC: HGNC:8023
Homologene: 1896
Npm1
Name: nucleophosmin 1
Synonyms: nucleolar protein NO38, B23, NO38
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18148
HGNC: HGNC:7910
Homologene: 81697
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Septin3
Name: septin 3
Synonyms: Sep3, B530002E20Rik, 3110018K01Rik, Sept3, Gm46500
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 24050
VEGA: 15
Homologene: 99740
Resp18
Name: regulated endocrine-specific protein 18
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19711
Homologene: 7516
Ctcf
Name: CCCTC-binding factor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13018
Homologene: 4786
Rps19
Name: ribosomal protein S19
Synonyms: Dsk3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20085
Homologene: 37416
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Suco
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Exo1
Name: exonuclease 1
Synonyms: Msa, 5730442G03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26909
HGNC: HGNC:3511
Homologene: 31352
Kif13b
Name: kinesin family member 13B
Synonyms: GAKIN, N-3 kinesin, C130021D12Rik, 5330429L19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16554
VEGA: 14
Homologene: 9073
Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: SREBP-2, nuc, SREBP2, SREBP2gc, bHLHd2, lop13
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Gtf3c1
Name: general transcription factor III C 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233863
HGNC: HGNC:4664
Homologene: 31040
Clasp2
Name: CLIP associating protein 2
Synonyms: 1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76499
VEGA: 9
Homologene: 24944
Snx5
Name: sorting nexin 5
Synonyms: 1810032P22Rik, 0910001N05Rik, D2Ertd52e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69178
Homologene: 40944
2700097O09Rik
Name: RIKEN cDNA 2700097O09 gene
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72658
Homologene: 36458
Xpo4
Name: exportin 4
Synonyms: B430309A01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57258
Homologene: 10733
Ppfibp2
Name: PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms: liprin beta 2, Cclp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19024
HGNC: HGNC:9250
Homologene: 7486
Blmh
Name: bleomycin hydrolase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104184
HGNC: HGNC:1059
Homologene: 330
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Mier2
Name: MIER family member 2
Synonyms: 2700087H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70427
Homologene: 18941
Unc5b
Name: unc-5 netrin receptor B
Synonyms: 6330415E02Rik, Unc5h2, D10Bwg0792e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 107449
VEGA: 10
Homologene: 32538
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101471
Homologene: 16377
Ermard
Name: ER membrane associated RNA degradation
Synonyms: 2410011O22Rik, 2210404J11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381062
Homologene: 19936
Ap5z1
Name: adaptor-related protein complex 5, zeta 1 subunit
Synonyms: C330006K01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231855
Homologene: 18213
Clca4a
Name: chloride channel accessory 4A
Synonyms: 9130020L07Rik, Clca6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99663
HGNC: HGNC:2018
Homologene: 40808
Reck
Name: reversion-inducing-cysteine-rich protein with kazal motifs
Synonyms: St15
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53614
Homologene: 9622
Dgke
Name: diacylglycerol kinase, epsilon
Synonyms: DAGK6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56077
HGNC: HGNC:2852
Homologene: 2705
Snapc5
Name: small nuclear RNA activating complex, polypeptide 5
Synonyms: 2010103A03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330959
VEGA: 9
Homologene: 4414
Paxbp1
Name: PAX3 and PAX7 binding protein 1
Synonyms: 1810007M14Rik, Pax3/7bp, Gcfc1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67367
Homologene: 9604
Septin10
Name: septin 10
Synonyms: 9430099J10Rik, 4921515A04Rik, Sept10
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103080
VEGA: 10
Homologene: 27035
Gorasp2
Name: golgi reassembly stacking protein 2
Synonyms: GRASP55, 5730520M13Rik, 9430094F20Rik, GOLPH2, GRS2, p59, ENSMUSG00000075299
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70231
Homologene: 9180
Sec24b
Name: SEC24 homolog B, COPII coat complex component
Synonyms: SEC24
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99683
Homologene: 55968
Ahcyl1
Name: S-adenosylhomocysteine hydrolase-like 1
Synonyms: DCAL, 1110034F20Rik, Ahcy-rs3, IRBIT
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229709
HGNC: HGNC:344
Homologene: 77353
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Pcdhb18
Name: protocadherin beta 18
Synonyms: Pcdhb9, PcdhbR
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Nr4a3
Name: nuclear receptor subfamily 4, group A, member 3
Synonyms: TEC, NOR-1, Nor1, MINOR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18124
HGNC: HGNC:7982
Homologene: 5074
Tas1r3
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83771
Homologene: 12890
Usf3
Name: upstream transcription factor family member 3
Synonyms: LOC207806, LOC385650, 5530400K22Rik, Gm608
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207806
Homologene: 19504
Trpc6
Name: transient receptor potential cation channel, subfamily C, member 6
Synonyms: mtrp6, Trrp6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22068
VEGA: 9
Homologene: 37944
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Trim9
Name: tripartite motif-containing 9
Synonyms: C030048G07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94090
VEGA: 12
Homologene: 9045
Agpat3
Name: 1-acylglycerol-3-phosphate O-acyltransferase 3
Synonyms: D10Jhu12e, LPAAT3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28169
HGNC: HGNC:326
Homologene: 10591
Slc9a5
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 5
Synonyms: LOC277973
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277973
Homologene: 31247
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Emilin2
Name: elastin microfibril interfacer 2
Synonyms: basilin, FOAP-10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 246707
VEGA: 17
Homologene: 36483
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Arnt2
Name: aryl hydrocarbon receptor nuclear translocator 2
Synonyms: bHLHe1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11864
Homologene: 7230
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Fgd5
Name: FYVE, RhoGEF and PH domain containing 5
Synonyms: ZFYVE23, C330025N11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232237
Homologene: 27798
Vmn2r1
Name: vomeronasal 2, receptor 1
Synonyms: EG56544, V2r83
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56544
Homologene: 84832
Rint1
Name: RAD50 interactor 1
Synonyms: 2810450M21Rik, 1500019C06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72772
Homologene: 11070
Or2aj4
Name: olfactory receptor family 2 subfamily AJ member 4
Synonyms: GA_x54KRFPKG5P-16014972-16014031, MOR273-3P, Olfr169
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258158
Homologene: 128058
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241116
Homologene: 28093
Thbs2
Name: thrombospondin 2
Synonyms: TSP2, Thbs-2, Thrombospondin-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21826
VEGA: 17
Homologene: 2438
Arhgef4
Name: Rho guanine nucleotide exchange factor 4
Synonyms: 9330140K16Rik, Asef, C230030N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Bbof1
Name: basal body orientation factor 1
Synonyms: 2900006K08Rik, Ccdc176
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72873
Homologene: 75215
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Nrap
Name: nebulin-related anchoring protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18175
HGNC: HGNC:7988
Homologene: 4499
Zfp110
Name: zinc finger protein 110
Synonyms: NRIF, 2900024E01Rik, Nrif1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 65020
Homologene: 129707
Ccdc30
Name: coiled-coil domain containing 30
Synonyms: 1700111D19Rik, 4930445I03Rik, 1700001O02Rik, 1700041C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73332
Homologene: 137391
Ms4a15
Name: membrane-spanning 4-domains, subfamily A, member 15
Synonyms: LOC383468, E530011F12Rik, Gm1286
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 545279
Homologene: 27391
Clcn4
Name: chloride channel, voltage-sensitive 4
Synonyms: Clc4-2, Clcn4-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12727
HGNC: HGNC:2022
Homologene: 68207
Msh5
Name: mutS homolog 5
Synonyms: G7, Mut5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17687
HGNC: HGNC:7328
Homologene: 8415
Arhgef33
Name: Rho guanine nucleotide exchange factor 33
Synonyms: LOC381112, Gm941
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381112
VEGA: 17
Homologene: 55190
Sipa1
Name: signal-induced proliferation associated gene 1
Synonyms: SPA-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20469
VEGA: 19
Homologene: 7940
Cenpu
Name: centromere protein U
Synonyms: 1700029A22Rik, Mlf1ip
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71876
Homologene: 11629
Gmppb
Name: GDP-mannose pyrophosphorylase B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 331026
Homologene: 5578
Pou6f2
Name: POU domain, class 6, transcription factor 2
Synonyms: RPF-1, D130006K24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218030
Aadacl4fm4
Name: AADACL4 family member 4
Synonyms: LOC230890, Gm436
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230890
Homologene: 135765
Efcab3
Name: EF-hand calcium binding domain 3
Synonyms: 4921510J17Rik, Efcab15, Gm11639, Gm11639, Efcab13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108167860
Homologene: 18304
Aldh3b3
Name: aldehyde dehydrogenase 3 family, member B3
Synonyms: 1700055N04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73458
HGNC: HGNC:411
Homologene: 133295
Dhrs7
Name: dehydrogenase/reductase 7
Synonyms: retSDR4, 2310016E22Rik, retDSR4, 5730564L20Rik, dehydrogenase/reductase (SDR family) member 7
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66375
VEGA: 12
Homologene: 9350
Sema4c
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
Synonyms: M-Sema F, Semaf, Semacl1, Semai, Semacl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20353
Homologene: 23047
Col26a1
Name: collagen, type XXVI, alpha 1
Synonyms: Emu2, 9430032K24Rik, Collagen XXVI, Emid2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140709
Homologene: 136636
Vmn1r236
Name: vomeronasal 1 receptor 236
Synonyms: V1rf4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171235
Rab1b
Name: RAB1B, member RAS oncogene family
Synonyms: 1110011F09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76308
VEGA: 19
Homologene: 128838
Pigq
Name: phosphatidylinositol glycan anchor biosynthesis, class Q
Synonyms: Gpi1p, Gpi1, Gpih, Gpi1h
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14755
Homologene: 31228
Maml3
Name: mastermind like transcriptional coactivator 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433586
Homologene: 41284
Bbs2
Name: Bardet-Biedl syndrome 2
Synonyms: 2410125H22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67378
HGNC: HGNC:967
Homologene: 12122
Slco5a1
Name: solute carrier organic anion transporter family, member 5A1
Synonyms: A630033C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240726
Homologene: 57135
Gdap1
Name: ganglioside-induced differentiation-associated-protein 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14545
Homologene: 40713
Hmx2
Name: H6 homeobox 2
Synonyms: Nkx5-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15372
HGNC: HGNC:5018
Homologene: 24625
Cdca7l
Name: cell division cycle associated 7 like
Synonyms: JPO2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217946
Homologene: 10285
Nova2
Name: NOVA alternative splicing regulator 2
Synonyms: LOC384569
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384569
HGNC: HGNC:7887
Homologene: 134398
Trav3-1
Name: T cell receptor alpha variable 3-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 667441
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
9030624G23Rik
Name: RIKEN cDNA 9030624G23 gene
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66808
VEGA: 12
Homologene: 136548
Gm11096
Name: predicted gene 11096
Type: Gene
Species: Mouse
Chromosome: 17
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 12,989,703 bp
  • T to C, chromosome 1 at 17,161,144 bp
  • T to C, chromosome 1 at 34,806,397 bp
  • A to C, chromosome 1 at 36,553,118 bp
  • T to C, chromosome 1 at 46,249,950 bp
  • T to A, chromosome 1 at 74,933,162 bp
  • C to T, chromosome 1 at 75,278,202 bp
  • A to T, chromosome 1 at 161,845,368 bp
  • A to G, chromosome 1 at 175,900,996 bp
  • A to G, chromosome 2 at 67,509,497 bp
  • T to C, chromosome 2 at 69,458,479 bp
  • G to A, chromosome 2 at 70,684,098 bp
  • T to A, chromosome 2 at 144,253,820 bp
  • A to G, chromosome 3 at 5,242,199 bp
  • G to T, chromosome 3 at 51,697,722 bp
  • A to G, chromosome 3 at 64,089,709 bp
  • C to T, chromosome 3 at 107,669,151 bp
  • A to T, chromosome 3 at 129,995,949 bp
  • A to G, chromosome 3 at 144,968,405 bp
  • T to C, chromosome 4 at 43,890,970 bp
  • T to A, chromosome 4 at 48,051,390 bp
  • C to T, chromosome 4 at 85,063,324 bp
  • A to T, chromosome 4 at 119,352,713 bp
  • A to T, chromosome 4 at 144,670,343 bp
  • A to G, chromosome 4 at 155,862,548 bp
  • A to C, chromosome 5 at 23,800,722 bp
  • A to G, chromosome 5 at 25,373,176 bp
  • C to T, chromosome 5 at 136,748,177 bp
  • T to A, chromosome 5 at 142,470,558 bp
  • A to T, chromosome 6 at 91,987,281 bp
  • G to A, chromosome 6 at 126,102,240 bp
  • A to G, chromosome 7 at 7,295,168 bp
  • T to A, chromosome 7 at 12,837,093 bp
  • A to T, chromosome 7 at 18,942,345 bp
  • A to T, chromosome 7 at 24,888,339 bp
  • A to T, chromosome 7 at 84,305,198 bp
  • T to A, chromosome 7 at 107,721,317 bp
  • T to C, chromosome 7 at 125,672,822 bp
  • T to A, chromosome 7 at 131,555,871 bp
  • C to A, chromosome 7 at 141,259,375 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • C to A, chromosome 8 at 46,562,464 bp
  • C to A, chromosome 8 at 94,081,136 bp
  • A to G, chromosome 8 at 105,363,366 bp
  • A to T, chromosome 8 at 105,664,058 bp
  • T to A, chromosome 8 at 112,752,197 bp
  • G to A, chromosome 9 at 8,655,218 bp
  • T to A, chromosome 9 at 64,179,332 bp
  • A to T, chromosome 9 at 108,050,571 bp
  • A to G, chromosome 9 at 113,903,948 bp
  • T to A, chromosome 10 at 39,088,329 bp
  • T to A, chromosome 10 at 59,181,049 bp
  • C to A, chromosome 10 at 60,779,730 bp
  • T to A, chromosome 10 at 78,283,200 bp
  • C to A, chromosome 10 at 79,541,885 bp
  • A to T, chromosome 11 at 33,156,001 bp
  • T to A, chromosome 11 at 76,945,895 bp
  • G to C, chromosome 11 at 77,454,626 bp
  • T to C, chromosome 11 at 89,040,856 bp
  • A to C, chromosome 11 at 105,117,324 bp
  • T to A, chromosome 11 at 105,921,825 bp
  • A to T, chromosome 12 at 8,011,933 bp
  • A to T, chromosome 12 at 24,044,723 bp
  • A to T, chromosome 12 at 55,059,510 bp
  • A to G, chromosome 12 at 55,747,149 bp
  • G to A, chromosome 12 at 70,255,187 bp
  • A to T, chromosome 12 at 72,652,460 bp
  • A to G, chromosome 12 at 84,419,989 bp
  • T to G, chromosome 12 at 110,616,457 bp
  • G to T, chromosome 12 at 117,873,732 bp
  • G to T, chromosome 13 at 18,125,448 bp
  • G to A, chromosome 14 at 52,581,093 bp
  • T to A, chromosome 14 at 57,602,591 bp
  • A to G, chromosome 14 at 64,736,149 bp
  • A to T, chromosome 15 at 82,177,240 bp
  • A to T, chromosome 15 at 82,285,819 bp
  • G to A, chromosome 16 at 19,566,722 bp
  • A to T, chromosome 16 at 44,216,202 bp
  • T to A, chromosome 16 at 91,025,278 bp
  • T to G, chromosome 17 at 14,676,221 bp
  • C to T, chromosome 17 at 15,063,613 bp
  • T to C, chromosome 17 at 21,287,466 bp
  • A to T, chromosome 17 at 25,937,325 bp
  • T to C, chromosome 17 at 35,044,379 bp
  • T to C, chromosome 17 at 71,273,913 bp
  • C to T, chromosome 17 at 80,373,485 bp
  • T to G, chromosome 17 at 81,441,899 bp
  • T to A, chromosome 18 at 37,490,467 bp
  • A to G, chromosome 19 at 3,964,871 bp
  • A to T, chromosome 19 at 5,100,496 bp
  • A to G, chromosome 19 at 5,652,662 bp
  • A to T, chromosome 19 at 10,979,330 bp
  • T to G, chromosome 19 at 56,354,152 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7895 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045947-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.