Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7895Btlr/Mmmh
Stock Number:
045947-MU
Citation ID:
RRID:MMRRC_045947-MU
Other Names:
R7895 (G1)
Major Collection:

Strain Information

Ntf3
Name: neurotrophin 3
Synonyms: NT-3, Ntf-3, NT3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18205
HGNC: HGNC:8023
Homologene: 1896
Npm1
Name: nucleophosmin 1
Synonyms: nucleolar protein NO38, B23, NO38
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18148
HGNC: HGNC:7910
Homologene: 81697
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Septin3
Name: septin 3
Synonyms: Sep3, B530002E20Rik, 3110018K01Rik, Gm46500, Sept3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 24050
VEGA: 15
Homologene: 99740
Resp18
Name: regulated endocrine-specific protein 18
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19711
Homologene: 7516
Ctcf
Name: CCCTC-binding factor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13018
Homologene: 4786
Rps19
Name: ribosomal protein S19
Synonyms: Dsk3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20085
Homologene: 37416
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 12,989,703 bp
  • T to C, chromosome 1 at 17,161,144 bp
  • T to C, chromosome 1 at 34,806,397 bp
  • A to C, chromosome 1 at 36,553,118 bp
  • T to C, chromosome 1 at 46,249,950 bp
  • T to A, chromosome 1 at 74,933,162 bp
  • C to T, chromosome 1 at 75,278,202 bp
  • A to T, chromosome 1 at 161,845,368 bp
  • A to G, chromosome 1 at 175,900,996 bp
  • A to G, chromosome 2 at 67,509,497 bp
  • T to C, chromosome 2 at 69,458,479 bp
  • G to A, chromosome 2 at 70,684,098 bp
  • T to A, chromosome 2 at 144,253,820 bp
  • A to G, chromosome 3 at 5,242,199 bp
  • G to T, chromosome 3 at 51,697,722 bp
  • A to G, chromosome 3 at 64,089,709 bp
  • C to T, chromosome 3 at 107,669,151 bp
  • A to T, chromosome 3 at 129,995,949 bp
  • A to G, chromosome 3 at 144,968,405 bp
  • T to C, chromosome 4 at 43,890,970 bp
  • T to A, chromosome 4 at 48,051,390 bp
  • C to T, chromosome 4 at 85,063,324 bp
  • A to T, chromosome 4 at 119,352,713 bp
  • A to T, chromosome 4 at 144,670,343 bp
  • A to G, chromosome 4 at 155,862,548 bp
  • A to C, chromosome 5 at 23,800,722 bp
  • A to G, chromosome 5 at 25,373,176 bp
  • C to T, chromosome 5 at 136,748,177 bp
  • T to A, chromosome 5 at 142,470,558 bp
  • A to T, chromosome 6 at 91,987,281 bp
  • G to A, chromosome 6 at 126,102,240 bp
  • A to G, chromosome 7 at 7,295,168 bp
  • T to A, chromosome 7 at 12,837,093 bp
  • A to T, chromosome 7 at 18,942,345 bp
  • A to T, chromosome 7 at 24,888,339 bp
  • A to T, chromosome 7 at 84,305,198 bp
  • T to A, chromosome 7 at 107,721,317 bp
  • T to C, chromosome 7 at 125,672,822 bp
  • T to A, chromosome 7 at 131,555,871 bp
  • C to A, chromosome 7 at 141,259,375 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • C to A, chromosome 8 at 46,562,464 bp
  • C to A, chromosome 8 at 94,081,136 bp
  • A to G, chromosome 8 at 105,363,366 bp
  • A to T, chromosome 8 at 105,664,058 bp
  • T to A, chromosome 8 at 112,752,197 bp
  • G to A, chromosome 9 at 8,655,218 bp
  • T to A, chromosome 9 at 64,179,332 bp
  • A to T, chromosome 9 at 108,050,571 bp
  • A to G, chromosome 9 at 113,903,948 bp
  • T to A, chromosome 10 at 39,088,329 bp
  • T to A, chromosome 10 at 59,181,049 bp
  • C to A, chromosome 10 at 60,779,730 bp
  • T to A, chromosome 10 at 78,283,200 bp
  • C to A, chromosome 10 at 79,541,885 bp
  • A to T, chromosome 11 at 33,156,001 bp
  • T to A, chromosome 11 at 76,945,895 bp
  • G to C, chromosome 11 at 77,454,626 bp
  • T to C, chromosome 11 at 89,040,856 bp
  • A to C, chromosome 11 at 105,117,324 bp
  • T to A, chromosome 11 at 105,921,825 bp
  • A to T, chromosome 12 at 8,011,933 bp
  • A to T, chromosome 12 at 24,044,723 bp
  • A to T, chromosome 12 at 55,059,510 bp
  • A to G, chromosome 12 at 55,747,149 bp
  • G to A, chromosome 12 at 70,255,187 bp
  • A to T, chromosome 12 at 72,652,460 bp
  • A to G, chromosome 12 at 84,419,989 bp
  • T to G, chromosome 12 at 110,616,457 bp
  • G to T, chromosome 12 at 117,873,732 bp
  • G to T, chromosome 13 at 18,125,448 bp
  • G to A, chromosome 14 at 52,581,093 bp
  • T to A, chromosome 14 at 57,602,591 bp
  • A to G, chromosome 14 at 64,736,149 bp
  • A to T, chromosome 15 at 82,177,240 bp
  • A to T, chromosome 15 at 82,285,819 bp
  • G to A, chromosome 16 at 19,566,722 bp
  • A to T, chromosome 16 at 44,216,202 bp
  • T to A, chromosome 16 at 91,025,278 bp
  • T to G, chromosome 17 at 14,676,221 bp
  • C to T, chromosome 17 at 15,063,613 bp
  • T to C, chromosome 17 at 21,287,466 bp
  • A to T, chromosome 17 at 25,937,325 bp
  • T to C, chromosome 17 at 35,044,379 bp
  • T to C, chromosome 17 at 71,273,913 bp
  • C to T, chromosome 17 at 80,373,485 bp
  • T to G, chromosome 17 at 81,441,899 bp
  • T to A, chromosome 18 at 37,490,467 bp
  • A to G, chromosome 19 at 3,964,871 bp
  • A to T, chromosome 19 at 5,100,496 bp
  • A to G, chromosome 19 at 5,652,662 bp
  • A to T, chromosome 19 at 10,979,330 bp
  • T to G, chromosome 19 at 56,354,152 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7895 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045947-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.