Strain Name:
C57BL/6J-MtgxR7896Btlr/Mmmh
Stock Number:
045948-MU
Citation ID:
RRID:MMRRC_045948-MU
Other Names:
R7896 (G1)
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Npr3
Name: natriuretic peptide receptor 3
Synonyms: Nppc receptor, lgj, longjohn, NPR-C, B430320C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18162
VEGA: 15
HGNC: HGNC:7945
Homologene: 699
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Cs
Name: citrate synthase
Synonyms: Cis, 2610511A05Rik, 9030605P22Rik, ahl4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12974
VEGA: 10
HGNC: HGNC:2422
Homologene: 56073
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Foxo3
Name: forkhead box O3
Synonyms: FKHRL1, Fkhr2, 2010203A17Rik, 1110048B16Rik, Foxo3a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56484
Homologene: 31039
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Rtn4
Name: reticulon 4
Synonyms: 1110020G17Rik, C130026I10Rik, NOGO, NgA, Nogo-B, Nogo-A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
R3hdm1
Name: R3H domain containing 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226412
HGNC: HGNC:9757
Homologene: 9108
Zfr
Name: zinc finger RNA binding protein
Synonyms: C920030H05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22763
Homologene: 8009
Slc38a2
Name: solute carrier family 38, member 2
Synonyms: 5033402L14Rik, SNAT2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67760
VEGA: 15
Homologene: 23132
Slc9a8
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms: NHE8, 1200006P13Rik, 6430709P13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77031
Homologene: 75041
Rapsn
Name: receptor-associated protein of the synapse
Synonyms: rapsyn, Raps, 43kDa acetylcholine receptor-associated protein, Nraps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19400
HGNC: HGNC:9863
Homologene: 3708
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, 2310003F20Rik, Tulip1, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Dolk
Name: dolichol kinase
Synonyms: Tmem15
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227697
Homologene: 8940
Adam19
Name: ADAM metallopeptidase domain 19
Synonyms: Mltnb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11492
HGNC: HGNC:197
Homologene: 74925
Rsrp1
Name: arginine/serine rich protein 1
Synonyms: D4Ucla2, 2700043I21Rik, D4Wsu53e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27981
Zfp65
Name: zinc finger protein 65
Synonyms: KRAB5, Zfp71-rs1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 235907
Homologene: 87875
Dpf2
Name: double PHD fingers 2
Synonyms: ubi-d4, Req, 2210010M07Rik, Baf45d, requiem
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19708
HGNC: HGNC:9964
Homologene: 21265
Bach1
Name: BTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms: 6230421P05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12013
HGNC: HGNC:935
Homologene: 916
Atp5pb
Name: ATP synthase peripheral stalk-membrane subunit b
Synonyms: C76477, Atp5f1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11950
HGNC: HGNC:840
Homologene: 1275
Paf1
Name: Paf1, RNA polymerase II complex component
Synonyms: 5730511K23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54624
Homologene: 5441
Alg8
Name: ALG8 alpha-1,3-glucosyltransferase
Synonyms: LOC381903
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381903
Homologene: 6931
Pprc1
Name: peroxisome proliferative activated receptor, gamma, coactivator-related 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226169
Homologene: 9006
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230676
Homologene: 49413
Tlr3
Name: toll-like receptor 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142980
Homologene: 20696
Chst9
Name: carbohydrate sulfotransferase 9
Synonyms: GalNAc4ST-2, 5430438D01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71367
Homologene: 12861
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Rbm22
Name: RNA binding motif protein 22
Synonyms: 8430430L24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66810
Homologene: 69245
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Nap1l5
Name: nucleosome assembly protein 1-like 5
Synonyms: 1110020M21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58243
Homologene: 36397
Zfp831
Name: zinc finger protein 831
Synonyms: ENSMUSG00000050600, OTTMUSG00000017459
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100043757
Homologene: 19013
Pde9a
Name: phosphodiesterase 9A
Synonyms: PDE9A1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18585
HGNC: HGNC:8795
Homologene: 113565
Usp40
Name: ubiquitin specific peptidase 40
Synonyms: B230215L03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227334
Homologene: 32400
Or2r3
Name: olfactory receptor family 2 subfamily R member 3
Synonyms: GA_x6K02T2P3E9-5088893-5089834, MOR257-1, Olfr457
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258989
Homologene: 133701
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, MINK, Ysk2, Map4k6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
D430041D05Rik
Name: RIKEN cDNA D430041D05 gene
Synonyms: G2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241589
Homologene: 115928
Actn2
Name: actinin alpha 2
Synonyms: 1110008F24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11472
HGNC: HGNC:164
Homologene: 31016
Srgap1
Name: SLIT-ROBO Rho GTPase activating protein 1
Synonyms: 4930572H05Rik, Arhgap13
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117600
Homologene: 56898
Myo1h
Name: myosin 1H
Synonyms: 4631401O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231646
Homologene: 82639
Abcc6
Name: ATP-binding cassette, sub-family C member 6
Synonyms: DCC, Mrp6, Dyscalc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27421
HGNC: HGNC:57
Homologene: 55559
Eml3
Name: echinoderm microtubule associated protein like 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225898
VEGA: 19
Homologene: 27044
Or13a20
Name: olfactory receptor family 13 subfamily A member 20
Synonyms: IE12, MOR253-5, GA_x6K02T2PBJ9-42798103-42799038, Olfr53
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258962
Homologene: 133678
Sppl2c
Name: signal peptide peptidase 2C
Synonyms: 4933407P14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237958
Homologene: 18491
Map1a
Name: microtubule-associated protein 1 A
Synonyms: Mtap-1, Mtap1, 6330416M19Rik, Mtap1a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17754
HGNC: HGNC:6835
Homologene: 1778
Ppp1r36
Name: protein phosphatase 1, regulatory subunit 36
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 210762
VEGA: 12
Homologene: 52094
Ppip5k1
Name: diphosphoinositol pentakisphosphate kinase 1
Synonyms: B430315C20Rik, Hisppd2a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 327655
Homologene: 49395
Unc5c
Name: unc-5 netrin receptor C
Synonyms: Unc5h3, B130051O18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22253
Homologene: 2765
D3Ertd751e
Name: DNA segment, Chr 3, ERATO Doi 751, expressed
Synonyms: 4930415G15Rik, 2810009O15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73852
Homologene: 12520
Zfp692
Name: zinc finger protein 692
Synonyms: Zfp692-ps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103836
Homologene: 9889
Ccdc154
Name: coiled-coil domain containing 154
Synonyms: LOC207209, ntl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 207209
Homologene: 19361
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Mmp8
Name: matrix metallopeptidase 8
Synonyms: Collagenase-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17394
VEGA: 9
HGNC: HGNC:7175
Homologene: 22482
Gm1527
Name: predicted gene 1527
Synonyms: LOC385263
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 385263
Homologene: 133976
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Setd7
Name: SET domain containing (lysine methyltransferase) 7
Synonyms: 1600028F23Rik, Set7, KMT7, Set7/9
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73251
Homologene: 12741
Abcc10
Name: ATP-binding cassette, sub-family C member 10
Synonyms: Mrp7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224814
HGNC: HGNC:52
Homologene: 58616
Vmn1r85
Name: vomeronasal 1 receptor 85
Synonyms: V1rj3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252909
Homologene: 74338
Fam184a
Name: family with sequence similarity 184, member A
Synonyms: 3110012E06Rik, 4930438C08Rik, 4930589M24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75906
Homologene: 11600
Vmn1r62
Name: vomeronasal 1 receptor 62
Synonyms: V3R2, V1rd8, V1rd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81016
Homologene: 41799
Rsph3a
Name: radial spoke 3A homolog (Chlamydomonas)
Synonyms: 4930524H12Rik, 1700012G05Rik, Rshl2, Rshl2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66832
VEGA: 17
Homologene: 12043
Abca7
Name: ATP-binding cassette, sub-family A member 7
Synonyms: Abc51
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27403
HGNC: HGNC:37
Homologene: 22783
Vmn2r67
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620672
Homologene: 115466
Actrt2
Name: actin-related protein T2
Synonyms: Arp-T2, 1700052K15Rik, Arpm2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73353
Homologene: 23647
Amz2
Name: archaelysin family metallopeptidase 2
Synonyms: ESTM12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13929
Prl7c1
Name: prolactin family 7, subfamily c, member 1
Synonyms: PLP-O, 1600017N11Rik, Prlpo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67505
Homologene: 137377
Entrep2
Name: endosomal transmembrane epsin interactor 2
Synonyms: 5730507A09Rik, Fam189a1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70638
Homologene: 77705
Cdc14a
Name: CDC14 cell division cycle 14A
Synonyms: CDC14A2, CDC14a1, Cdc14, A830059A17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229776
HGNC: HGNC:1718
Homologene: 75343
Ppl
Name: periplakin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19041
VEGA: 16
HGNC: HGNC:9273
Homologene: 2026
Dcdc2c
Name: doublecortin domain containing 2C
Synonyms: 1110015M06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68511
Homologene: 131934
Gstt1
Name: glutathione S-transferase, theta 1
Synonyms: Gstt1-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14871
HGNC: HGNC:4641
Homologene: 134739
Lrrc57
Name: leucine rich repeat containing 57
Synonyms: 2810002D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66606
Homologene: 11995
Mup18
Name: major urinary protein 18
Synonyms: Gm12561
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100048884
Homologene: 74304
Pcmtd2
Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
Synonyms: 5330414D10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245867
Homologene: 10099
Bcl6b
Name: B cell CLL/lymphoma 6, member B
Synonyms: Bazf
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12029
HGNC: HGNC:1002
Homologene: 7243
Zfp383
Name: zinc finger protein 383
Synonyms: 1110003H10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73729
Homologene: 128413
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Catspere2
Name: cation channel sperm associated auxiliary subunit epsilon 2
Synonyms: Gm30473, EG545391, Gm16432
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545391
Gm49380
Name: predicted gene, 49380
Type: Gene
Species: Mouse
Chromosome: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 87,978,479 bp
  • T to A, chromosome 1 at 128,168,966 bp
  • A to T, chromosome 1 at 178,111,174 bp
  • A to T, chromosome 2 at 30,285,949 bp
  • T to C, chromosome 2 at 76,794,674 bp
  • T to C, chromosome 2 at 91,044,955 bp
  • T to C, chromosome 2 at 104,258,040 bp
  • C to A, chromosome 2 at 120,607,891 bp
  • A to G, chromosome 2 at 121,305,176 bp
  • T to C, chromosome 2 at 121,347,330 bp
  • A to G, chromosome 2 at 142,834,075 bp
  • T to C, chromosome 2 at 167,465,358 bp
  • A to T, chromosome 2 at 174,647,128 bp
  • T to C, chromosome 2 at 181,854,983 bp
  • T to G, chromosome 3 at 28,921,593 bp
  • T to A, chromosome 3 at 41,756,073 bp
  • C to A, chromosome 3 at 51,536,656 bp
  • A to G, chromosome 3 at 105,955,943 bp
  • T to C, chromosome 3 at 116,294,833 bp
  • A to T, chromosome 3 at 141,771,161 bp
  • G to T, chromosome 4 at 61,672,688 bp
  • A to T, chromosome 4 at 118,402,913 bp
  • A to T, chromosome 4 at 134,923,963 bp
  • A to T, chromosome 4 at 154,667,195 bp
  • G to T, chromosome 5 at 114,336,311 bp
  • T to A, chromosome 6 at 42,472,166 bp
  • C to T, chromosome 6 at 58,906,520 bp
  • A to T, chromosome 7 at 5,675,610 bp
  • T to A, chromosome 7 at 13,084,521 bp
  • T to C, chromosome 7 at 28,396,647 bp
  • C to A, chromosome 7 at 29,912,201 bp
  • A to G, chromosome 7 at 45,977,379 bp
  • T to C, chromosome 7 at 64,776,809 bp
  • A to G, chromosome 7 at 85,136,712 bp
  • T to C, chromosome 7 at 97,390,916 bp
  • G to T, chromosome 7 at 140,652,901 bp
  • T to A, chromosome 8 at 45,397,053 bp
  • A to T, chromosome 9 at 7,564,977 bp
  • G to A, chromosome 9 at 44,112,799 bp
  • T to C, chromosome 10 at 42,197,736 bp
  • C to A, chromosome 10 at 53,633,706 bp
  • A to G, chromosome 10 at 75,784,142 bp
  • A to G, chromosome 10 at 80,004,958 bp
  • C to T, chromosome 10 at 116,369,457 bp
  • A to G, chromosome 10 at 119,978,545 bp
  • CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC to CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC, chromosome 10 at 121,853,553 bp
  • A to G, chromosome 10 at 127,242,004 bp
  • C to T, chromosome 10 at 128,353,135 bp
  • T to G, chromosome 11 at 29,705,536 bp
  • T to A, chromosome 11 at 46,137,543 bp
  • A to G, chromosome 11 at 58,314,236 bp
  • G to T, chromosome 11 at 70,227,022 bp
  • A to G, chromosome 11 at 70,612,282 bp
  • A to G, chromosome 11 at 104,187,130 bp
  • G to A, chromosome 11 at 109,436,587 bp
  • G to A, chromosome 12 at 28,470,620 bp
  • A to G, chromosome 12 at 55,697,878 bp
  • A to G, chromosome 12 at 76,035,623 bp
  • A to G, chromosome 12 at 76,428,149 bp
  • G to A, chromosome 13 at 12,294,317 bp
  • A to T, chromosome 13 at 27,778,087 bp
  • A to T, chromosome 13 at 67,729,055 bp
  • A to T, chromosome 14 at 72,455,738 bp
  • A to G, chromosome 15 at 11,883,362 bp
  • T to A, chromosome 15 at 12,146,377 bp
  • A to G, chromosome 15 at 38,041,573 bp
  • A to G, chromosome 15 at 96,693,585 bp
  • C to T, chromosome 16 at 5,088,861 bp
  • T to G, chromosome 16 at 15,708,903 bp
  • T to A, chromosome 16 at 87,719,005 bp
  • G to A, chromosome 16 at 91,818,558 bp
  • A to G, chromosome 17 at 7,946,108 bp
  • A to T, chromosome 17 at 25,171,826 bp
  • C to T, chromosome 17 at 31,459,967 bp
  • G to A, chromosome 17 at 35,620,025 bp
  • T to A, chromosome 17 at 46,324,309 bp
  • T to A, chromosome 17 at 65,985,685 bp
  • G to T, chromosome 17 at 74,622,082 bp
  • C to T, chromosome 18 at 15,452,789 bp
  • G to T, chromosome 18 at 60,569,433 bp
  • C to T, chromosome 19 at 5,904,305 bp
  • C to A, chromosome 19 at 6,532,053 bp
  • T to A, chromosome 19 at 8,933,807 bp
  • T to C, chromosome 19 at 46,061,449 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7896 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045948-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.