Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7896Btlr/Mmmh
Stock Number:
045948-MU
Citation ID:
RRID:MMRRC_045948-MU
Other Names:
R7896 (G1)
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Npr3
Name: natriuretic peptide receptor 3
Synonyms: Nppc receptor, lgj, longjohn, NPR-C, B430320C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18162
VEGA: 15
HGNC: HGNC:7945
Homologene: 699
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Cs
Name: citrate synthase
Synonyms: Cis, 2610511A05Rik, 9030605P22Rik, ahl4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12974
VEGA: 10
HGNC: HGNC:2422
Homologene: 56073
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 87,978,479 bp
  • T to A, chromosome 1 at 128,168,966 bp
  • A to T, chromosome 1 at 178,111,174 bp
  • A to T, chromosome 2 at 30,285,949 bp
  • T to C, chromosome 2 at 76,794,674 bp
  • T to C, chromosome 2 at 91,044,955 bp
  • T to C, chromosome 2 at 104,258,040 bp
  • C to A, chromosome 2 at 120,607,891 bp
  • A to G, chromosome 2 at 121,305,176 bp
  • T to C, chromosome 2 at 121,347,330 bp
  • A to G, chromosome 2 at 142,834,075 bp
  • T to C, chromosome 2 at 167,465,358 bp
  • A to T, chromosome 2 at 174,647,128 bp
  • T to C, chromosome 2 at 181,854,983 bp
  • T to G, chromosome 3 at 28,921,593 bp
  • T to A, chromosome 3 at 41,756,073 bp
  • C to A, chromosome 3 at 51,536,656 bp
  • A to G, chromosome 3 at 105,955,943 bp
  • T to C, chromosome 3 at 116,294,833 bp
  • A to T, chromosome 3 at 141,771,161 bp
  • G to T, chromosome 4 at 61,672,688 bp
  • A to T, chromosome 4 at 118,402,913 bp
  • A to T, chromosome 4 at 134,923,963 bp
  • A to T, chromosome 4 at 154,667,195 bp
  • G to T, chromosome 5 at 114,336,311 bp
  • T to A, chromosome 6 at 42,472,166 bp
  • C to T, chromosome 6 at 58,906,520 bp
  • A to T, chromosome 7 at 5,675,610 bp
  • T to A, chromosome 7 at 13,084,521 bp
  • T to C, chromosome 7 at 28,396,647 bp
  • C to A, chromosome 7 at 29,912,201 bp
  • A to G, chromosome 7 at 45,977,379 bp
  • T to C, chromosome 7 at 64,776,809 bp
  • A to G, chromosome 7 at 85,136,712 bp
  • T to C, chromosome 7 at 97,390,916 bp
  • G to T, chromosome 7 at 140,652,901 bp
  • T to A, chromosome 8 at 45,397,053 bp
  • A to T, chromosome 9 at 7,564,977 bp
  • G to A, chromosome 9 at 44,112,799 bp
  • T to C, chromosome 10 at 42,197,736 bp
  • C to A, chromosome 10 at 53,633,706 bp
  • A to G, chromosome 10 at 75,784,142 bp
  • A to G, chromosome 10 at 80,004,958 bp
  • C to T, chromosome 10 at 116,369,457 bp
  • A to G, chromosome 10 at 119,978,545 bp
  • CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC to CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC, chromosome 10 at 121,853,553 bp
  • A to G, chromosome 10 at 127,242,004 bp
  • C to T, chromosome 10 at 128,353,135 bp
  • T to G, chromosome 11 at 29,705,536 bp
  • T to A, chromosome 11 at 46,137,543 bp
  • A to G, chromosome 11 at 58,314,236 bp
  • G to T, chromosome 11 at 70,227,022 bp
  • A to G, chromosome 11 at 70,612,282 bp
  • A to G, chromosome 11 at 104,187,130 bp
  • G to A, chromosome 11 at 109,436,587 bp
  • G to A, chromosome 12 at 28,470,620 bp
  • A to G, chromosome 12 at 55,697,878 bp
  • A to G, chromosome 12 at 76,035,623 bp
  • A to G, chromosome 12 at 76,428,149 bp
  • G to A, chromosome 13 at 12,294,317 bp
  • A to T, chromosome 13 at 27,778,087 bp
  • A to T, chromosome 13 at 67,729,055 bp
  • A to T, chromosome 14 at 72,455,738 bp
  • A to G, chromosome 15 at 11,883,362 bp
  • T to A, chromosome 15 at 12,146,377 bp
  • A to G, chromosome 15 at 38,041,573 bp
  • A to G, chromosome 15 at 96,693,585 bp
  • C to T, chromosome 16 at 5,088,861 bp
  • T to G, chromosome 16 at 15,708,903 bp
  • T to A, chromosome 16 at 87,719,005 bp
  • G to A, chromosome 16 at 91,818,558 bp
  • A to G, chromosome 17 at 7,946,108 bp
  • A to T, chromosome 17 at 25,171,826 bp
  • C to T, chromosome 17 at 31,459,967 bp
  • G to A, chromosome 17 at 35,620,025 bp
  • T to A, chromosome 17 at 46,324,309 bp
  • T to A, chromosome 17 at 65,985,685 bp
  • G to T, chromosome 17 at 74,622,082 bp
  • C to T, chromosome 18 at 15,452,789 bp
  • G to T, chromosome 18 at 60,569,433 bp
  • C to T, chromosome 19 at 5,904,305 bp
  • C to A, chromosome 19 at 6,532,053 bp
  • T to A, chromosome 19 at 8,933,807 bp
  • T to C, chromosome 19 at 46,061,449 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7896 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045948-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.