Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7898Btlr/Mmmh
Stock Number:
045950-MU
Citation ID:
RRID:MMRRC_045950-MU
Other Names:
R7898 (G1)
Major Collection:

Strain Information

Ighm
Name: immunoglobulin heavy constant mu
Synonyms: Ig mu, Igh6, Igh-M, muH, IgM
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16019
HGNC: HGNC:5541
Eno2
Name: enolase 2, gamma neuronal
Synonyms: Eno-2, D6Ertd375e, NSE
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13807
HGNC: HGNC:3353
Homologene: 74414
Fezf2
Name: Fez family zinc finger 2
Synonyms: forebrain embryonic zinc finger, Fez, Fezl, Zfp312
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54713
VEGA: 14
Homologene: 9957
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Prss12
Name: serine protease 12 neurotrypsin (motopsin)
Synonyms: Bssp-3, motopsin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19142
HGNC: HGNC:9477
Homologene: 7490
Slc17a6
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms: 2900073D12Rik, VGLUT2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140919
Homologene: 121617
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Tnpo3
Name: transportin 3
Synonyms: 5730544L10Rik, C430013M08Rik, D6Ertd313e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320938
Homologene: 40848
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Arl5b
Name: ADP-ribosylation factor-like 5B
Synonyms: 4930587A11Rik, Arl8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75869
Homologene: 101695
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69719
HGNC: HGNC:1424
Homologene: 1412
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Afg2a
Name: AFG2 AAA ATPase homolog A
Synonyms: 2510048F20Rik, Spaf, C78064, Spata5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57815
Homologene: 56920
Asxl1
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228790
Homologene: 9098
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195018
Homologene: 9027
Dbf4
Name: DBF4 zinc finger
Synonyms: Ask
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27214
Homologene: 40892
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Mcm3ap
Name: minichromosome maintenance complex component 3 associated protein
Synonyms: GANP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54387
VEGA: 10
HGNC: HGNC:6946
Homologene: 2902
Dcdc2a
Name: doublecortin domain containing 2a
Synonyms: RU2, Dcdc2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195208
Homologene: 9483
Chd2
Name: chromodomain helicase DNA binding protein 2
Synonyms: 2810040A01Rik, 2810013C04Rik, 5630401D06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244059
HGNC: HGNC:1917
Homologene: 37462
Prr14l
Name: proline rich 14-like
Synonyms: 6030436E02Rik, C330019G07Rik, Prl14l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 215476
Homologene: 65866
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: acetyl-CoA carboxylase, Acc1, LOC327983, Acac, A530025K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Klhl12
Name: kelch-like 12
Synonyms: C3ip1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240756
Homologene: 23317
Zfp74
Name: zinc finger protein 74
Synonyms: Zfp66, KRAB8, 2810054M15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72723
Homologene: 51861
Isl2
Name: insulin related protein 2 (islet 2)
Synonyms: islet 2, islet-2, 3110001N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104360
Homologene: 10730
Pbx1
Name: pre B cell leukemia homeobox 1
Synonyms: Pbx-1, D230003C07Rik, 2310056B04Rik, Pbx1a, Pbx1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18514
HGNC: HGNC:8632
Homologene: 20574
Pwp2
Name: PWP2 periodic tryptophan protein homolog (yeast)
Synonyms: Pwp2, 6530411D08Rik, Pwp2h
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110816
VEGA: 10
HGNC: HGNC:9711
Homologene: 3702
Sec31a
Name: SEC31 homolog A, COPII coat complex component
Synonyms: 1810024J13Rik, Sec31l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69162
Homologene: 42056
Mettl23
Name: methyltransferase like 23
Synonyms: 4933424L15Rik, 1500035B17Rik, 1110005A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74319
Homologene: 12552
Mis18bp1
Name: MIS18 binding protein 1
Synonyms: C79407
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217653
Homologene: 10147
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Siglec15
Name: sialic acid binding Ig-like lectin 15
Synonyms: EG620235, Cd33l3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 620235
Homologene: 52643
Hspa1b
Name: heat shock protein 1B
Synonyms: hsp68, Hsp70.1, Hsp70-1, HSP70B1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15511
HGNC: HGNC:5233
Homologene: 133785
Pierce1
Name: piercer of microtubule wall 1
Synonyms: 1700007K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69327
Homologene: 35416
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Arnt2
Name: aryl hydrocarbon receptor nuclear translocator 2
Synonyms: bHLHe1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11864
Homologene: 7230
Rhobtb2
Name: Rho-related BTB domain containing 2
Synonyms: Dbc2, E130206H14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 246710
VEGA: 14
Homologene: 22873
Cfap251
Name: cilia and flagella associated protein 251
Synonyms: 4930415N18Rik, 4933428F06Rik, Wdr66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269701
Homologene: 16964
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: GluR1, GluR-A, Glr-1, Glur-1, Glur1, GluRA, Glr1, 2900051M01Rik, HIPA1, GluA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Myom1
Name: myomesin 1
Synonyms: skelemin, D430047A17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17929
VEGA: 17
HGNC: HGNC:7613
Homologene: 31196
Plxnb1
Name: plexin B1
Synonyms: 2900002G15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235611
HGNC: HGNC:9103
Homologene: 130508
Spag4
Name: sperm associated antigen 4
Synonyms: 1700041K21Rik, Sun4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245865
Homologene: 2343
Grm8
Name: glutamate receptor, metabotropic 8
Synonyms: mGluR8, Gprc1h
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14823
HGNC: HGNC:4600
Homologene: 654
Tmem9
Name: transmembrane protein 9
Synonyms: 1500015G18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66241
Homologene: 9515
Iftap
Name: intraflagellar transport associated protein
Synonyms: NWC, B230118H07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68170
Homologene: 16348
Fam124b
Name: family with sequence similarity 124, member B
Synonyms: A830043J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241128
Homologene: 65263
Iqca1l
Name: IQ motif containing with AAA domain 1 like
Synonyms: 4931409K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231045
Homologene: 18602
Rusf1
Name: RUS family member 1
Synonyms: BC017158
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233913
Homologene: 11232
Pcdhb17
Name: protocadherin beta 17
Synonyms: Pcdhb16, PcdhbQ
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93888
Homologene: 81881
Mettl24
Name: methyltransferase like 24
Synonyms: 9030224M15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327747
Homologene: 65335
Prss56
Name: serine protease 56
Synonyms: Prss56, 1700027L20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69453
Homologene: 79885
Pex13
Name: peroxisomal biogenesis factor 13
Synonyms: 2610008O20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72129
HGNC: HGNC:8855
Homologene: 1967
Eef2k
Name: eukaryotic elongation factor-2 kinase
Synonyms: eEF-2K
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13631
Homologene: 7299
Or52n5
Name: olfactory receptor family 52 subfamily N member 5
Synonyms: GA_x6K02T2PBJ9-7567376-7568329, MOR34-6, Olfr669
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259045
Homologene: 72057
Cdo1
Name: cysteine dioxygenase 1, cytosolic
Synonyms: Cdo, D18Ucla3, 1300002L19Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12583
VEGA: 18
HGNC: HGNC:1795
Homologene: 1365
Gbp11
Name: guanylate binding protein 11
Synonyms: Gm7141
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 634650
Homologene: 128731
Ppl
Name: periplakin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19041
VEGA: 16
HGNC: HGNC:9273
Homologene: 2026
Lgalsl2
Name: galectin like 2
Synonyms: Gm5065
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 272350
Gdpd1
Name: glycerophosphodiester phosphodiesterase domain containing 1
Synonyms: 2610020H15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66569
Homologene: 7069
Wdr81
Name: WD repeat domain 81
Synonyms: shakey 5, MGC32441, nur5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192652
Homologene: 13983
Ankef1
Name: ankyrin repeat and EF-hand domain containing 1
Synonyms: Ankrd5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319196
Homologene: 11130
Herpud1
Name: homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Synonyms: Herp, Mifl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64209
Homologene: 40973
Nkx2-9
Name: NK2 homeobox 9
Synonyms: tinman, Nkx-2.9, Nkx2.9
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18094
Homologene: 7444
Znrf4
Name: zinc and ring finger 4
Synonyms: spzn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20834
VEGA: 17
Homologene: 7959
Mup18
Name: major urinary protein 18
Synonyms: Gm12561
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100048884
Homologene: 74304
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 12,805,294 bp
  • T to A, chromosome 1 at 80,213,795 bp
  • A to G, chromosome 1 at 87,184,199 bp
  • A to T, chromosome 1 at 134,458,481 bp
  • T to A, chromosome 1 at 136,027,387 bp
  • A to T, chromosome 1 at 168,185,047 bp
  • T to A, chromosome 2 at 15,075,058 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • T to C, chromosome 2 at 69,441,366 bp
  • T to A, chromosome 2 at 101,586,402 bp
  • C to A, chromosome 2 at 136,553,698 bp
  • T to G, chromosome 2 at 153,399,934 bp
  • A to T, chromosome 2 at 156,069,324 bp
  • A to C, chromosome 2 at 157,993,470 bp
  • T to G, chromosome 3 at 37,420,471 bp
  • A to G, chromosome 3 at 88,983,625 bp
  • T to C, chromosome 3 at 123,506,496 bp
  • T to A, chromosome 4 at 55,012,995 bp
  • G to T, chromosome 4 at 61,672,688 bp
  • A to G, chromosome 5 at 8,408,232 bp
  • T to C, chromosome 5 at 24,553,645 bp
  • A to G, chromosome 5 at 31,061,485 bp
  • A to T, chromosome 5 at 32,829,966 bp
  • C to T, chromosome 5 at 100,399,477 bp
  • T to C, chromosome 5 at 105,324,932 bp
  • T to A, chromosome 5 at 121,331,817 bp
  • A to T, chromosome 5 at 123,322,454 bp
  • T to C, chromosome 5 at 124,782,361 bp
  • G to A, chromosome 6 at 27,762,423 bp
  • T to C, chromosome 6 at 29,565,224 bp
  • A to T, chromosome 6 at 70,672,313 bp
  • C to T, chromosome 6 at 124,767,262 bp
  • G to A, chromosome 7 at 5,359,442 bp
  • A to T, chromosome 7 at 29,935,955 bp
  • G to A, chromosome 7 at 51,658,825 bp
  • A to G, chromosome 7 at 73,519,475 bp
  • A to T, chromosome 7 at 84,268,947 bp
  • C to T, chromosome 7 at 104,939,366 bp
  • A to G, chromosome 7 at 120,895,218 bp
  • C to A, chromosome 7 at 128,298,005 bp
  • C to T, chromosome 8 at 94,392,200 bp
  • C to A, chromosome 9 at 55,542,439 bp
  • A to G, chromosome 9 at 109,114,340 bp
  • A to G, chromosome 9 at 110,384,743 bp
  • A to G, chromosome 10 at 40,810,482 bp
  • A to G, chromosome 10 at 76,506,607 bp
  • G to A, chromosome 10 at 78,173,406 bp
  • C to A, chromosome 11 at 23,650,929 bp
  • T to A, chromosome 11 at 57,242,765 bp
  • T to G, chromosome 11 at 72,796,547 bp
  • T to C, chromosome 11 at 75,453,899 bp
  • T to C, chromosome 11 at 84,364,449 bp
  • T to A, chromosome 11 at 87,041,813 bp
  • T to C, chromosome 11 at 116,845,853 bp
  • G to A, chromosome 12 at 56,612,246 bp
  • A to G, chromosome 12 at 65,149,472 bp
  • T to A, chromosome 12 at 113,421,253 bp
  • A to T, chromosome 13 at 25,102,378 bp
  • A to G, chromosome 14 at 12,342,701 bp
  • C to T, chromosome 14 at 69,796,297 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • C to T, chromosome 16 at 5,088,861 bp
  • T to A, chromosome 16 at 37,044,883 bp
  • T to A, chromosome 17 at 25,392,276 bp
  • T to C, chromosome 17 at 34,958,191 bp
  • A to G, chromosome 17 at 56,511,681 bp
  • T to C, chromosome 17 at 71,045,752 bp
  • T to C, chromosome 17 at 71,377,818 bp
  • A to T, chromosome 18 at 37,485,180 bp
  • A to G, chromosome 18 at 46,728,090 bp
  • A to T, chromosome 18 at 78,043,699 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7898 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045950-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.