Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7898Btlr/Mmmh
Stock Number:
045950-MU
Citation ID:
RRID:MMRRC_045950-MU
Other Names:
R7898 (G1)
Major Collection:

Strain Information

Ighm
Name: immunoglobulin heavy constant mu
Synonyms: Ig mu, Igh6, Igh-M, muH, IgM, TC1460681
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16019
HGNC: HGNC:5541
Eno2
Name: enolase 2, gamma neuronal
Synonyms: Eno-2, D6Ertd375e, NSE
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13807
HGNC: HGNC:3353
Homologene: 74414
Fezf2
Name: Fez family zinc finger 2
Synonyms: forebrain embryonic zinc finger, Fez, Fezl, Zfp312
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54713
VEGA: 14
Homologene: 9957
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Prss12
Name: serine protease 12 neurotrypsin (motopsin)
Synonyms: Bssp-3, motopsin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19142
HGNC: HGNC:9477
Homologene: 7490
Slc17a6
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms: 2900073D12Rik, VGLUT2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140919
Homologene: 121617
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 12,805,294 bp
  • T to A, chromosome 1 at 80,213,795 bp
  • A to G, chromosome 1 at 87,184,199 bp
  • A to T, chromosome 1 at 134,458,481 bp
  • T to A, chromosome 1 at 136,027,387 bp
  • A to T, chromosome 1 at 168,185,047 bp
  • T to A, chromosome 2 at 15,075,058 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • T to C, chromosome 2 at 69,441,366 bp
  • T to A, chromosome 2 at 101,586,402 bp
  • C to A, chromosome 2 at 136,553,698 bp
  • T to G, chromosome 2 at 153,399,934 bp
  • A to T, chromosome 2 at 156,069,324 bp
  • A to C, chromosome 2 at 157,993,470 bp
  • T to G, chromosome 3 at 37,420,471 bp
  • A to G, chromosome 3 at 88,983,625 bp
  • T to C, chromosome 3 at 123,506,496 bp
  • T to A, chromosome 4 at 55,012,995 bp
  • G to T, chromosome 4 at 61,672,688 bp
  • A to G, chromosome 5 at 8,408,232 bp
  • T to C, chromosome 5 at 24,553,645 bp
  • A to G, chromosome 5 at 31,061,485 bp
  • A to T, chromosome 5 at 32,829,966 bp
  • C to T, chromosome 5 at 100,399,477 bp
  • T to C, chromosome 5 at 105,324,932 bp
  • T to A, chromosome 5 at 121,331,817 bp
  • A to T, chromosome 5 at 123,322,454 bp
  • T to C, chromosome 5 at 124,782,361 bp
  • G to A, chromosome 6 at 27,762,423 bp
  • T to C, chromosome 6 at 29,565,224 bp
  • A to T, chromosome 6 at 70,672,313 bp
  • C to T, chromosome 6 at 124,767,262 bp
  • G to A, chromosome 7 at 5,359,442 bp
  • A to T, chromosome 7 at 29,935,955 bp
  • G to A, chromosome 7 at 51,658,825 bp
  • A to G, chromosome 7 at 73,519,475 bp
  • A to T, chromosome 7 at 84,268,947 bp
  • C to T, chromosome 7 at 104,939,366 bp
  • A to G, chromosome 7 at 120,895,218 bp
  • C to A, chromosome 7 at 128,298,005 bp
  • C to T, chromosome 8 at 94,392,200 bp
  • C to A, chromosome 9 at 55,542,439 bp
  • A to G, chromosome 9 at 109,114,340 bp
  • A to G, chromosome 9 at 110,384,743 bp
  • A to G, chromosome 10 at 40,810,482 bp
  • A to G, chromosome 10 at 76,506,607 bp
  • G to A, chromosome 10 at 78,173,406 bp
  • C to A, chromosome 11 at 23,650,929 bp
  • T to A, chromosome 11 at 57,242,765 bp
  • T to G, chromosome 11 at 72,796,547 bp
  • T to C, chromosome 11 at 75,453,899 bp
  • T to C, chromosome 11 at 84,364,449 bp
  • T to A, chromosome 11 at 87,041,813 bp
  • T to C, chromosome 11 at 116,845,853 bp
  • G to A, chromosome 12 at 56,612,246 bp
  • A to G, chromosome 12 at 65,149,472 bp
  • T to A, chromosome 12 at 113,421,253 bp
  • A to T, chromosome 13 at 25,102,378 bp
  • A to G, chromosome 14 at 12,342,701 bp
  • C to T, chromosome 14 at 69,796,297 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • C to T, chromosome 16 at 5,088,861 bp
  • T to A, chromosome 16 at 37,044,883 bp
  • T to A, chromosome 17 at 25,392,276 bp
  • T to C, chromosome 17 at 34,958,191 bp
  • A to G, chromosome 17 at 56,511,681 bp
  • T to C, chromosome 17 at 71,045,752 bp
  • T to C, chromosome 17 at 71,377,818 bp
  • A to T, chromosome 18 at 37,485,180 bp
  • A to G, chromosome 18 at 46,728,090 bp
  • A to T, chromosome 18 at 78,043,699 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7898 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045950-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.