Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7901Btlr/Mmmh
Stock Number:
045953-MU
Citation ID:
RRID:MMRRC_045953-MU
Other Names:
R7901 (G1)
Major Collection:

Strain Information

Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Tnpo3
Name: transportin 3
Synonyms: 5730544L10Rik, C430013M08Rik, D6Ertd313e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320938
Homologene: 40848
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 2810004D21Rik, 4632404O06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Ccnt1
Name: cyclin T1
Synonyms: CycT1, 2810478G24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12455
HGNC: HGNC:1599
Homologene: 947
Slc45a4
Name: solute carrier family 45, member 4
Synonyms: 9330175B01Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106068
Homologene: 69908
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: eyem02Jus, heb, QBRICK, crf11, eyes2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Tsg101
Name: tumor susceptibility gene 101
Synonyms: CC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22088
Homologene: 4584
Arhgap17
Name: Rho GTPase activating protein 17
Synonyms: WBP15, Nadrin, Rich1, 5730403H17Rik, Nadrin2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70497
Homologene: 9984
Or4m1
Name: olfactory receptor family 4 subfamily M member 1
Synonyms: GA_x6K02T2PMLR-6013665-6012724, MOR242-1, Olfr734
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258658
Homologene: 51759
Zfp592
Name: zinc finger protein 592
Synonyms: A730014M16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233410
Homologene: 8759
Zfp738
Name: zinc finger protein 738
Synonyms: 6720487G11Rik, 3830402I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408068
Homologene: 133713
Ddx17
Name: DEAD box helicase 17
Synonyms: A430025E01Rik, LOC381024, 2610007K22Rik, p72, DEAD (Asp-Glu-Ala-Asp) box polypeptide 17
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67040
VEGA: 15
HGNC: HGNC:2740
Homologene: 101101
Unkl
Name: unkempt family like zinc finger
Synonyms: 1300004G08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74154
Homologene: 62673
Lct
Name: lactase
Synonyms: LOC226413, Lphl, LPH
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226413
HGNC: HGNC:6530
Homologene: 124204
Ell2
Name: elongation factor for RNA polymerase II 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 192657
VEGA: 13
Homologene: 8094
Zfyve28
Name: zinc finger, FYVE domain containing 28
Synonyms: 9630058O20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231125
Homologene: 15119
Snx13
Name: sorting nexin 13
Synonyms: RGS-PX1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217463
VEGA: 12
Homologene: 41011
Or51a6
Name: olfactory receptor family 51 subfamily A member 6
Synonyms: GA_x6K02T2PBJ9-5666843-5665908, MOR8-1, Olfr575
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259118
Homologene: 122786
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Gpld1
Name: glycosylphosphatidylinositol specific phospholipase D1
Synonyms: 6330541J12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14756
HGNC: HGNC:4459
Homologene: 1152
Agfg2
Name: ArfGAP with FG repeats 2
Synonyms: A630095P14Rik, Hrbl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231801
HGNC: HGNC:5177
Homologene: 4430
Asb8
Name: ankyrin repeat and SOCS box-containing 8
Synonyms: C430011H06Rik, 4930539L19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78541
Homologene: 32572
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Col4a2
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12827
HGNC: HGNC:2203
Homologene: 1390
Ablim1
Name: actin-binding LIM protein 1
Synonyms: Limab1, abLIM-S, abLIM-M, abLIM-L, 4833406P10Rik, 2610209L21Rik, 9330196J19Rik, 2210411C18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226251
HGNC: HGNC:78
Homologene: 40994
Atp6v0a2
Name: ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms: TJ6s, Tj6, ATP6a2, Atp6n2, 8430408C20Rik, V-ATPase a2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21871
Homologene: 56523
Ppip5k1
Name: diphosphoinositol pentakisphosphate kinase 1
Synonyms: B430315C20Rik, Hisppd2a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 327655
Homologene: 49395
Uts2r
Name: urotensin 2 receptor
Synonyms: urotensin II receptor, UTR2, Gpr14
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217369
HGNC: HGNC:4468
Homologene: 10345
Mrs2
Name: MRS2 magnesium transporter
Synonyms: LOC380836, Mrs2l
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380836
Homologene: 31983
Eme1
Name: essential meiotic structure-specific endonuclease 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268465
Homologene: 16123
H2-T10
Name: histocompatibility 2, T region locus 10
Synonyms: H-2T10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15024
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Klk1b1
Name: kallikrein 1-related peptidase b1
Synonyms: mGK-1, TK, tissue kallikrein, mK1, Klk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16623
HGNC: HGNC:6357
Homologene: 68141
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Rgl2
Name: ral guanine nucleotide dissociation stimulator-like 2
Synonyms: Rlf, KE1.5, Rab2l, Rgt2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19732
HGNC: HGNC:9769
Homologene: 3494
Gabrg2
Name: gamma-aminobutyric acid type A receptor, subunit gamma 2
Synonyms: Gabrg-2, gamma2, GABAA-R
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14406
HGNC: HGNC:4087
Homologene: 22443
Zfp664
Name: zinc finger protein 664
Synonyms: D930038J03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269704
Homologene: 65046
Skint1
Name: selection and upkeep of intraepithelial T cells 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639781
Homologene: 87538
Gsc
Name: goosecoid homeobox
Synonyms: goosecoid
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14836
HGNC: HGNC:4612
Homologene: 7744
Fndc9
Name: fibronectin type III domain containing 9
Synonyms: C030019I05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320116
Homologene: 37404
Nlrp6
Name: NLR family, pyrin domain containing 6
Synonyms: Nalp6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101613
Homologene: 15881
Ifi213
Name: interferon activated gene 213
Synonyms: E030037K03Rik, Pydc4, Pyr-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 623121
Homologene: 115929
Muc13
Name: mucin 13, epithelial transmembrane
Synonyms: 114/A10, Ly64
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17063
HGNC: HGNC:7511
Homologene: 7822
Adpgk
Name: ADP-dependent glucokinase
Synonyms: 2610017G09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72141
VEGA: 9
Homologene: 41739
Csf1r
Name: colony stimulating factor 1 receptor
Synonyms: CSF-1R, M-CSFR, CD115, Fim-2, Fms, Csfmr, Fim2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12978
HGNC: HGNC:2433
Homologene: 3817
Klra4
Name: killer cell lectin-like receptor, subfamily A, member 4
Synonyms: Chok, Ly49d, ly49r129
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16635
Homologene: 110821
Or10v1
Name: olfactory receptor family 10 subfamily V member 1
Synonyms: GA_x6K02T2RE5P-2247227-2248156, MOR266-4, Olfr1420
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258405
Homologene: 17234
Gm5145
Name: predicted pseudogene 5145
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381065
VEGA: 17
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Wbp4
Name: WW domain binding protein 4
Synonyms: FBP21
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22380
VEGA: 14
Homologene: 38287
Spcs1
Name: signal peptidase complex subunit 1 homolog (S. cerevisiae)
Synonyms: 1810004F21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69019
Homologene: 40915
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 128,288,985 bp
  • A to T, chromosome 1 at 173,567,218 bp
  • G to T, chromosome 1 at 189,657,248 bp
  • T to C, chromosome 2 at 20,290,010 bp
  • T to C, chromosome 2 at 121,311,909 bp
  • G to T, chromosome 4 at 82,959,377 bp
  • A to C, chromosome 4 at 112,019,202 bp
  • C to T, chromosome 4 at 148,010,745 bp
  • C to T, chromosome 5 at 34,224,982 bp
  • C to T, chromosome 5 at 124,641,547 bp
  • A to T, chromosome 5 at 124,885,775 bp
  • A to T, chromosome 5 at 137,667,704 bp
  • T to C, chromosome 6 at 29,568,991 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to G, chromosome 6 at 130,063,150 bp
  • T to C, chromosome 7 at 43,971,245 bp
  • G to T, chromosome 7 at 46,913,435 bp
  • T to G, chromosome 7 at 81,024,721 bp
  • T to C, chromosome 7 at 102,955,680 bp
  • A to T, chromosome 7 at 123,286,568 bp
  • T to C, chromosome 7 at 140,927,440 bp
  • ACAGCAGCTGGACTGACAGCAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG to ACAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,164,865 bp
  • A to T, chromosome 8 at 11,429,358 bp
  • T to C, chromosome 9 at 59,315,017 bp
  • T to G, chromosome 9 at 82,890,150 bp
  • C to T, chromosome 10 at 8,780,564 bp
  • T to A, chromosome 10 at 18,141,964 bp
  • C to G, chromosome 10 at 116,369,428 bp
  • A to G, chromosome 11 at 41,976,591 bp
  • T to C, chromosome 11 at 46,237,749 bp
  • G to T, chromosome 11 at 94,650,819 bp
  • G to A, chromosome 11 at 121,161,408 bp
  • T to A, chromosome 12 at 35,100,625 bp
  • C to T, chromosome 12 at 57,688,567 bp
  • T to A, chromosome 12 at 104,472,872 bp
  • T to A, chromosome 13 at 24,962,775 bp
  • T to A, chromosome 13 at 25,018,566 bp
  • A to T, chromosome 13 at 67,672,991 bp
  • A to T, chromosome 13 at 75,763,986 bp
  • A to G, chromosome 14 at 31,000,671 bp
  • A to T, chromosome 14 at 50,320,116 bp
  • A to T, chromosome 14 at 50,826,851 bp
  • A to T, chromosome 14 at 79,472,405 bp
  • C to T, chromosome 15 at 8,116,442 bp
  • A to G, chromosome 15 at 8,269,706 bp
  • G to A, chromosome 15 at 73,605,772 bp
  • A to T, chromosome 15 at 79,538,588 bp
  • T to C, chromosome 15 at 98,142,733 bp
  • A to T, chromosome 15 at 98,543,916 bp
  • A to G, chromosome 16 at 33,815,841 bp
  • T to C, chromosome 16 at 59,557,544 bp
  • A to C, chromosome 17 at 20,570,638 bp
  • T to C, chromosome 17 at 25,218,653 bp
  • T to C, chromosome 17 at 33,935,825 bp
  • C to T, chromosome 17 at 36,120,251 bp
  • T to A, chromosome 18 at 61,110,296 bp
  • A to T, chromosome 19 at 11,896,534 bp
  • A to T, chromosome 19 at 57,131,002 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7901 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045953-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.