Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7901Btlr/Mmmh
Stock Number:
045953-MU
Citation ID:
RRID:MMRRC_045953-MU
Other Names:
R7901 (G1)
Major Collection:

Strain Information

Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Tnpo3
Name: transportin 3
Synonyms: 5730544L10Rik, C430013M08Rik, D6Ertd313e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320938
Homologene: 40848
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 2810004D21Rik, 4632404O06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 128,288,985 bp
  • A to T, chromosome 1 at 173,567,218 bp
  • G to T, chromosome 1 at 189,657,248 bp
  • T to C, chromosome 2 at 20,290,010 bp
  • T to C, chromosome 2 at 121,311,909 bp
  • G to T, chromosome 4 at 82,959,377 bp
  • A to C, chromosome 4 at 112,019,202 bp
  • C to T, chromosome 4 at 148,010,745 bp
  • C to T, chromosome 5 at 34,224,982 bp
  • C to T, chromosome 5 at 124,641,547 bp
  • A to T, chromosome 5 at 124,885,775 bp
  • A to T, chromosome 5 at 137,667,704 bp
  • T to C, chromosome 6 at 29,568,991 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to G, chromosome 6 at 130,063,150 bp
  • T to C, chromosome 7 at 43,971,245 bp
  • G to T, chromosome 7 at 46,913,435 bp
  • T to G, chromosome 7 at 81,024,721 bp
  • T to C, chromosome 7 at 102,955,680 bp
  • A to T, chromosome 7 at 123,286,568 bp
  • T to C, chromosome 7 at 140,927,440 bp
  • ACAGCAGCTGGACTGACAGCAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG to ACAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,164,865 bp
  • A to T, chromosome 8 at 11,429,358 bp
  • T to C, chromosome 9 at 59,315,017 bp
  • T to G, chromosome 9 at 82,890,150 bp
  • C to T, chromosome 10 at 8,780,564 bp
  • T to A, chromosome 10 at 18,141,964 bp
  • C to G, chromosome 10 at 116,369,428 bp
  • A to G, chromosome 11 at 41,976,591 bp
  • T to C, chromosome 11 at 46,237,749 bp
  • G to T, chromosome 11 at 94,650,819 bp
  • G to A, chromosome 11 at 121,161,408 bp
  • T to A, chromosome 12 at 35,100,625 bp
  • C to T, chromosome 12 at 57,688,567 bp
  • T to A, chromosome 12 at 104,472,872 bp
  • T to A, chromosome 13 at 24,962,775 bp
  • T to A, chromosome 13 at 25,018,566 bp
  • A to T, chromosome 13 at 67,672,991 bp
  • A to T, chromosome 13 at 75,763,986 bp
  • A to G, chromosome 14 at 31,000,671 bp
  • A to T, chromosome 14 at 50,320,116 bp
  • A to T, chromosome 14 at 50,826,851 bp
  • A to T, chromosome 14 at 79,472,405 bp
  • C to T, chromosome 15 at 8,116,442 bp
  • A to G, chromosome 15 at 8,269,706 bp
  • G to A, chromosome 15 at 73,605,772 bp
  • A to T, chromosome 15 at 79,538,588 bp
  • T to C, chromosome 15 at 98,142,733 bp
  • A to T, chromosome 15 at 98,543,916 bp
  • A to G, chromosome 16 at 33,815,841 bp
  • T to C, chromosome 16 at 59,557,544 bp
  • A to C, chromosome 17 at 20,570,638 bp
  • T to C, chromosome 17 at 25,218,653 bp
  • T to C, chromosome 17 at 33,935,825 bp
  • C to T, chromosome 17 at 36,120,251 bp
  • T to A, chromosome 18 at 61,110,296 bp
  • A to T, chromosome 19 at 11,896,534 bp
  • A to T, chromosome 19 at 57,131,002 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7901 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045953-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.