Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7923Btlr/Mmmh
Stock Number:
045970-MU
Citation ID:
RRID:MMRRC_045970-MU
Other Names:
R7923 (G1)
Major Collection:

Strain Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: Nkcc2, mBSC1, D630042G03Rik, urehr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20495
Homologene: 286
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
B4galt1
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms: Ggtb, Ggtb2, B-1,4-GalT1, beta-1,4-GalT1, GalT, beta 1,4-Galactosyltransferase I, b1,4-Galactosyltransferase I
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14595
HGNC: HGNC:924
Homologene: 20378
Npy5r
Name: neuropeptide Y receptor Y5
Synonyms: Y5R
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18168
HGNC: HGNC:7958
Homologene: 21241
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 38,800,762 bp
  • C to T, chromosome 1 at 39,650,903 bp
  • C to T, chromosome 1 at 68,259,209 bp
  • T to C, chromosome 1 at 131,300,413 bp
  • T to C, chromosome 1 at 170,794,706 bp
  • T to A, chromosome 1 at 195,168,687 bp
  • T to C, chromosome 2 at 69,438,388 bp
  • G to T, chromosome 2 at 79,662,615 bp
  • A to T, chromosome 2 at 125,214,092 bp
  • A to T, chromosome 2 at 155,625,966 bp
  • A to T, chromosome 2 at 177,945,887 bp
  • A to G, chromosome 3 at 108,265,129 bp
  • A to T, chromosome 3 at 142,567,612 bp
  • C to T, chromosome 4 at 40,809,373 bp
  • A to T, chromosome 4 at 94,961,765 bp
  • G to A, chromosome 4 at 109,315,872 bp
  • A to G, chromosome 4 at 118,373,840 bp
  • C to T, chromosome 5 at 22,134,692 bp
  • G to A, chromosome 5 at 69,561,159 bp
  • A to T, chromosome 5 at 76,609,692 bp
  • A to G, chromosome 5 at 91,994,699 bp
  • C to T, chromosome 5 at 96,739,318 bp
  • T to C, chromosome 5 at 108,680,583 bp
  • T to A, chromosome 5 at 125,511,884 bp
  • AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC to AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC, chromosome 5 at 134,711,081 bp
  • A to T, chromosome 6 at 48,765,627 bp
  • T to C, chromosome 6 at 56,883,042 bp
  • T to C, chromosome 6 at 70,960,716 bp
  • G to A, chromosome 6 at 72,427,917 bp
  • A to G, chromosome 6 at 116,226,424 bp
  • T to C, chromosome 6 at 139,633,793 bp
  • C to A, chromosome 7 at 28,766,263 bp
  • G to A, chromosome 7 at 29,339,146 bp
  • A to T, chromosome 7 at 30,549,661 bp
  • T to C, chromosome 7 at 35,195,129 bp
  • A to G, chromosome 7 at 38,521,914 bp
  • T to C, chromosome 7 at 68,190,101 bp
  • GGCG to GGCGACGGCCGCG, chromosome 7 at 97,579,906 bp
  • T to A, chromosome 7 at 106,714,442 bp
  • A to G, chromosome 7 at 118,143,322 bp
  • C to T, chromosome 7 at 127,393,324 bp
  • T to A, chromosome 8 at 3,531,737 bp
  • A to C, chromosome 8 at 13,738,456 bp
  • T to C, chromosome 8 at 24,576,193 bp
  • CAGCATCTGCTCGGAGCA to CAGCA, chromosome 8 at 26,160,856 bp
  • G to A, chromosome 8 at 27,124,190 bp
  • A to G, chromosome 8 at 66,681,752 bp
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp
  • C to T, chromosome 8 at 72,444,911 bp
  • T to A, chromosome 8 at 84,029,461 bp
  • T to A, chromosome 8 at 105,194,593 bp
  • T to A, chromosome 8 at 105,385,058 bp
  • T to C, chromosome 8 at 122,496,444 bp
  • A to G, chromosome 8 at 123,332,987 bp
  • A to T, chromosome 9 at 39,942,967 bp
  • A to G, chromosome 9 at 52,065,901 bp
  • G to T, chromosome 9 at 53,624,166 bp
  • A to G, chromosome 9 at 79,678,493 bp
  • A to T, chromosome 9 at 110,631,446 bp
  • C to T, chromosome 10 at 5,264,738 bp
  • T to C, chromosome 10 at 57,801,045 bp
  • T to C, chromosome 10 at 62,445,081 bp
  • A to T, chromosome 10 at 77,811,537 bp
  • G to T, chromosome 11 at 24,163,680 bp
  • T to C, chromosome 11 at 49,180,738 bp
  • C to T, chromosome 11 at 49,430,605 bp
  • A to G, chromosome 11 at 61,363,403 bp
  • A to T, chromosome 11 at 70,791,515 bp
  • T to G, chromosome 11 at 84,885,710 bp
  • A to G, chromosome 11 at 95,023,458 bp
  • A to T, chromosome 11 at 115,982,699 bp
  • C to A, chromosome 11 at 116,457,337 bp
  • A to G, chromosome 12 at 58,992,247 bp
  • G to T, chromosome 12 at 72,619,358 bp
  • T to A, chromosome 13 at 67,042,185 bp
  • T to C, chromosome 15 at 75,996,446 bp
  • C to A, chromosome 16 at 32,274,047 bp
  • A to G, chromosome 17 at 8,929,132 bp
  • A to G, chromosome 17 at 32,546,747 bp
  • T to A, chromosome 17 at 34,742,380 bp
  • A to T, chromosome 17 at 71,496,301 bp
  • T to C, chromosome 18 at 76,858,721 bp
  • T to A, chromosome 19 at 4,746,799 bp
  • T to C, chromosome 19 at 8,847,519 bp
  • T to C, chromosome 19 at 13,410,818 bp
  • C to T, chromosome 19 at 29,628,658 bp
  • T to A, chromosome 19 at 40,806,849 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7923 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045970-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.