Strain Name:
C57BL/6J-MtgxR7923Btlr/Mmmh
Stock Number:
045970-MU
Citation ID:
RRID:MMRRC_045970-MU
Other Names:
R7923 (G1)
Major Collection:

Strain Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: Nkcc2, mBSC1, D630042G03Rik, urehr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20495
Homologene: 286
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
B4galt1
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms: Ggtb, Ggtb2, B-1,4-GalT1, beta-1,4-GalT1, GalT, beta 1,4-Galactosyltransferase I, b1,4-Galactosyltransferase I
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14595
HGNC: HGNC:924
Homologene: 20378
Npy5r
Name: neuropeptide Y receptor Y5
Synonyms: Y5R
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18168
HGNC: HGNC:7958
Homologene: 21241
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Mysm1
Name: myb-like, SWIRM and MPN domains 1
Synonyms: C530050H10Rik, C130067A03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320713
Homologene: 66204
Sec23a
Name: SEC23 homolog A, COPII coat complex component
Synonyms: Sec23r, Msec23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20334
Homologene: 4642
Ndc80
Name: NDC80 kinetochore complex component
Synonyms: HEC1, 2610020P18Rik, Kntc2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67052
VEGA: 17
Homologene: 38141
Atf6
Name: activating transcription factor 6
Synonyms: ESTM49, 9130025P16Rik, Atf6alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226641
HGNC: HGNC:791
Homologene: 32015
Washc2
Name: WASH complex subunit 2
Synonyms: C530005J20Rik, D6Wsu116e, Fam21
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28006
Homologene: 41686
Psma5
Name: proteasome subunit alpha 5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26442
HGNC: HGNC:9534
Homologene: 2084
Sipa1l3
Name: signal-induced proliferation-associated 1 like 3
Synonyms: 2610511M17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74206
Homologene: 77938
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Itprid2
Name: ITPR interacting domain containing 2
Synonyms: SPAG13, CS-1, CS1, KRAP, Ssfa2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70599
Homologene: 4912
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Cbfb
Name: core binding factor beta
Synonyms: Pebp2, PEA2, Pebpb2, PEBP2b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12400
HGNC: HGNC:1539
Homologene: 11173
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234344
Homologene: 128518
Cep135
Name: centrosomal protein 135
Synonyms: LOC381644, Cep4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381644
Homologene: 45709
Nt5c3
Name: 5'-nucleotidase, cytosolic III
Synonyms: p36, lupin, Umph-1, 2610206B05Rik, PN-1, cN-III, PSN1, PN-I, Umph1, 1600024P05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107569
Homologene: 9534
Cul5
Name: cullin 5
Synonyms: 4921514I20Rik, C330021I08Rik, C030032G03Rik, VACM-1, 8430423K24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75717
HGNC: HGNC:2556
Homologene: 2597
Thap1
Name: THAP domain containing, apoptosis associated protein 1
Synonyms: 4833431A01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73754
Homologene: 10005
Brf2
Name: BRF2, RNA polymerase III transcription initiation factor 50kDa subunit
Synonyms: BRFU, TFIIIB50, 5730512K07Rik, 2700059M06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66653
Homologene: 10127
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235627
Homologene: 86422
Scimp
Name: SLP adaptor and CSK interacting membrane protein
Synonyms: A430084P05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327957
Homologene: 52602
Btnl9
Name: butyrophilin-like 9
Synonyms: D330012D11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237754
Homologene: 68540
Eps15
Name: epidermal growth factor receptor pathway substrate 15
Synonyms: 2410112D09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13858
HGNC: HGNC:3419
Homologene: 128359
Sptbn2
Name: spectrin beta, non-erythrocytic 2
Synonyms: Spnb3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20743
VEGA: 19
Homologene: 48482
Pnpla6
Name: patatin-like phospholipase domain containing 6
Synonyms: Swiss-cheese, MSws, Nte
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50767
Homologene: 21333
Myo19
Name: myosin XIX
Synonyms: 1110055A02Rik, Myohd1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66196
Homologene: 49819
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230676
Homologene: 49413
Piezo1
Name: piezo-type mechanosensitive ion channel component 1
Synonyms: Piezo1, Fam38a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234839
Homologene: 124356
Skor2
Name: SKI family transcriptional corepressor 2
Synonyms: Fussel18, Corl2, Gm7348
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 664805
VEGA: 18
Homologene: 64797
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Pik3c2g
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18705
HGNC: HGNC:8973
Homologene: 3362
Kctd19
Name: potassium channel tetramerisation domain containing 19
Synonyms: 4922504H04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 279499
Homologene: 18630
Or8d6
Name: olfactory receptor family 8 subfamily D member 6
Synonyms: GA_x6K02T2PVTD-33640290-33641222, MOR171-1, Olfr974
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259111
VEGA: 9
Homologene: 133680
Proser3
Name: proline and serine rich 3
Synonyms: BC053749
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 333193
Homologene: 116064
Mapk15
Name: mitogen-activated protein kinase 15
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 332110
Homologene: 16371
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668940
Homologene: 66117
Itgb4
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192897
HGNC: HGNC:6158
Homologene: 179
Eln
Name: elastin
Synonyms: tropoelastin, E030024M20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13717
HGNC: HGNC:3327
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Ermp1
Name: endoplasmic reticulum metallopeptidase 1
Synonyms: D19Ertd410e, D19Wsu12e, b2b2633Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226090
Homologene: 121891
Guf1
Name: GUF1 homolog, GTPase
Synonyms: mtEF4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231279
Homologene: 6505
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Zfp712
Name: zinc finger protein 712
Synonyms: 4921504N20Rik, mszf31, mszf89
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78251
VEGA: 13
Homologene: 136296
Supv3l1
Name: suppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms: 6330443E10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 338359
Homologene: 2386
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Spire2
Name: spire type actin nucleation factor 2
Synonyms: Spir-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234857
Homologene: 72212
Gbp3
Name: guanylate binding protein 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55932
Homologene: 137329
Bscl2
Name: BSCL2 lipid droplet biogenesis associated, seipin
Synonyms: seipin, Gng3lg
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14705
Homologene: 32032
Smco1
Name: single-pass membrane protein with coiled-coil domains 1
Synonyms: 2310010M20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69576
Homologene: 18842
Palm3
Name: paralemmin 3
Synonyms: 4432412L15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74337
Homologene: 53493
Aacs
Name: acetoacetyl-CoA synthetase
Synonyms: 2210408B16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78894
Homologene: 11322
Gimap3
Name: GTPase, IMAP family member 3
Synonyms: 2010110D23Rik, Ian4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 83408
Homologene: 41257
Cr2
Name: complement receptor 2
Synonyms: CD21, CD35, Cr-1, Cr-2, Cr1, C3DR
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Slc47a1
Name: solute carrier family 47, member 1
Synonyms: 1300013J15Rik, MATE1, mMATE1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67473
Homologene: 34364
Ido2
Name: indoleamine 2,3-dioxygenase 2
Synonyms: C230043N17Rik, Ido2, Indol1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209176
Homologene: 48830
Or2y1d
Name: olfactory receptor family 2 subfamily Y member 1D
Synonyms: GA_x6K02T2QP88-6004387-6003452, MOR256-1, Olfr1389
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259069
Homologene: 86690
1700030K09Rik
Name: RIKEN cDNA 1700030K09 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72254
Homologene: 12975
Cyp4f16
Name: cytochrome P450, family 4, subfamily f, polypeptide 16
Synonyms: 2310021J05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70101
Homologene: 135840
Smpdl3a
Name: sphingomyelin phosphodiesterase, acid-like 3A
Synonyms: 0610010C24Rik, ASM3A, ASML3A
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57319
Homologene: 4886
Or2ag13
Name: olfactory receptor family 2 subfamily AG member 13
Synonyms: GA_x6K02T2PBJ9-9092181-9091234, MOR283-6, Olfr695
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258591
Homologene: 133597
Ggcx
Name: gamma-glutamyl carboxylase
Synonyms: vitamin K-dependent carboxylase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56316
HGNC: HGNC:4247
Homologene: 639
Zfp764l1
Name: zinc finger protein 764 like 1
Synonyms: E430018J23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101604
Homologene: 138471
Nfkbib
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta
Synonyms: IKappaBbeta, IkB
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18036
HGNC: HGNC:7798
Homologene: 37631
Slc7a10
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 10
Synonyms: Asc-1, D7Bwg0847e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53896
Homologene: 56767
Or5b3
Name: olfactory receptor family 5 subfamily B member 3
Synonyms: GA_x6K02T2RE5P-3743369-3744289, MOR202-11, Olfr1469
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258690
HGNC: HGNC:8324
Homologene: 133675
Creg2
Name: cellular repressor of E1A-stimulated genes 2
Synonyms: A830098L22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 263764
Homologene: 17827
Lonrf2
Name: LON peptidase N-terminal domain and ring finger 2
Synonyms: 2900060P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381338
Homologene: 18871
Bcl11a
Name: BCL11 transcription factor A
Synonyms: COUP-TF interacting protein 1, CTIP1, mouse myeloid leukemia gene, Evi9, 2810047E18Rik, D930021L15Rik, Evi9c, Evi9b, Evi9a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14025
Homologene: 11284
Gm5591
Name: predicted gene 5591
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434171
Homologene: 80005
Samd14
Name: sterile alpha motif domain containing 14
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217125
Homologene: 17130
Odaph
Name: odontogenesis associated phosphoprotein
Synonyms: LOC381651, Gm1045
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381651
Homologene: 52269
Cfap97d2
Name: CFAP97 domain containing 2
Synonyms: 4932443I19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 403185
Dhrs7l
Name: dehydrogenase/reductase 7 like 1
Synonyms: Gm4756
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209183
Homologene: 134116
Cc2d2b
Name: coiled-coil and C2 domain containing 2B
Synonyms: EG668310
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668310
Homologene: 141114
Krtap10-27
Name: keratin associated protein 10-27
Synonyms: Gm9507
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 670880
Homologene: 115744
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 38,800,762 bp
  • C to T, chromosome 1 at 39,650,903 bp
  • C to T, chromosome 1 at 68,259,209 bp
  • T to C, chromosome 1 at 131,300,413 bp
  • T to C, chromosome 1 at 170,794,706 bp
  • T to A, chromosome 1 at 195,168,687 bp
  • T to C, chromosome 2 at 69,438,388 bp
  • G to T, chromosome 2 at 79,662,615 bp
  • A to T, chromosome 2 at 125,214,092 bp
  • A to T, chromosome 2 at 155,625,966 bp
  • A to T, chromosome 2 at 177,945,887 bp
  • A to G, chromosome 3 at 108,265,129 bp
  • A to T, chromosome 3 at 142,567,612 bp
  • C to T, chromosome 4 at 40,809,373 bp
  • A to T, chromosome 4 at 94,961,765 bp
  • G to A, chromosome 4 at 109,315,872 bp
  • A to G, chromosome 4 at 118,373,840 bp
  • C to T, chromosome 5 at 22,134,692 bp
  • G to A, chromosome 5 at 69,561,159 bp
  • A to T, chromosome 5 at 76,609,692 bp
  • A to G, chromosome 5 at 91,994,699 bp
  • C to T, chromosome 5 at 96,739,318 bp
  • T to C, chromosome 5 at 108,680,583 bp
  • T to A, chromosome 5 at 125,511,884 bp
  • AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC to AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC, chromosome 5 at 134,711,081 bp
  • A to T, chromosome 6 at 48,765,627 bp
  • T to C, chromosome 6 at 56,883,042 bp
  • T to C, chromosome 6 at 70,960,716 bp
  • G to A, chromosome 6 at 72,427,917 bp
  • A to G, chromosome 6 at 116,226,424 bp
  • T to C, chromosome 6 at 139,633,793 bp
  • C to A, chromosome 7 at 28,766,263 bp
  • G to A, chromosome 7 at 29,339,146 bp
  • A to T, chromosome 7 at 30,549,661 bp
  • T to C, chromosome 7 at 35,195,129 bp
  • A to G, chromosome 7 at 38,521,914 bp
  • T to C, chromosome 7 at 68,190,101 bp
  • GGCG to GGCGACGGCCGCG, chromosome 7 at 97,579,906 bp
  • T to A, chromosome 7 at 106,714,442 bp
  • A to G, chromosome 7 at 118,143,322 bp
  • C to T, chromosome 7 at 127,393,324 bp
  • T to A, chromosome 8 at 3,531,737 bp
  • A to C, chromosome 8 at 13,738,456 bp
  • T to C, chromosome 8 at 24,576,193 bp
  • CAGCATCTGCTCGGAGCA to CAGCA, chromosome 8 at 26,160,856 bp
  • G to A, chromosome 8 at 27,124,190 bp
  • A to G, chromosome 8 at 66,681,752 bp
  • GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC to GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC, chromosome 8 at 66,860,548 bp
  • C to T, chromosome 8 at 72,444,911 bp
  • T to A, chromosome 8 at 84,029,461 bp
  • T to A, chromosome 8 at 105,194,593 bp
  • T to A, chromosome 8 at 105,385,058 bp
  • T to C, chromosome 8 at 122,496,444 bp
  • A to G, chromosome 8 at 123,332,987 bp
  • A to T, chromosome 9 at 39,942,967 bp
  • A to G, chromosome 9 at 52,065,901 bp
  • G to T, chromosome 9 at 53,624,166 bp
  • A to G, chromosome 9 at 79,678,493 bp
  • A to T, chromosome 9 at 110,631,446 bp
  • C to T, chromosome 10 at 5,264,738 bp
  • T to C, chromosome 10 at 57,801,045 bp
  • T to C, chromosome 10 at 62,445,081 bp
  • A to T, chromosome 10 at 77,811,537 bp
  • G to T, chromosome 11 at 24,163,680 bp
  • T to C, chromosome 11 at 49,180,738 bp
  • C to T, chromosome 11 at 49,430,605 bp
  • A to G, chromosome 11 at 61,363,403 bp
  • A to T, chromosome 11 at 70,791,515 bp
  • T to G, chromosome 11 at 84,885,710 bp
  • A to G, chromosome 11 at 95,023,458 bp
  • A to T, chromosome 11 at 115,982,699 bp
  • C to A, chromosome 11 at 116,457,337 bp
  • A to G, chromosome 12 at 58,992,247 bp
  • G to T, chromosome 12 at 72,619,358 bp
  • T to A, chromosome 13 at 67,042,185 bp
  • T to C, chromosome 15 at 75,996,446 bp
  • C to A, chromosome 16 at 32,274,047 bp
  • A to G, chromosome 17 at 8,929,132 bp
  • A to G, chromosome 17 at 32,546,747 bp
  • T to A, chromosome 17 at 34,742,380 bp
  • A to T, chromosome 17 at 71,496,301 bp
  • T to C, chromosome 18 at 76,858,721 bp
  • T to A, chromosome 19 at 4,746,799 bp
  • T to C, chromosome 19 at 8,847,519 bp
  • T to C, chromosome 19 at 13,410,818 bp
  • C to T, chromosome 19 at 29,628,658 bp
  • T to A, chromosome 19 at 40,806,849 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7923 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045970-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.