Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7930Btlr/Mmmh
Stock Number:
045977-MU
Citation ID:
RRID:MMRRC_045977-MU
Other Names:
R7930 (G1)
Major Collection:

Strain Information

Tlx3
Name: T cell leukemia, homeobox 3
Synonyms: Tlx1l2, Rnx, Hox11l2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27140
Homologene: 23181
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29869
Homologene: 5891
Sntb2
Name: syntrophin, basic 2
Synonyms: Snt2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20650
Homologene: 4911
Rnf220
Name: ring finger protein 220
Synonyms: 5730503K05Rik, 4931406I20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66743
Homologene: 10036
Ddx23
Name: DEAD box helicase 23
Synonyms: 4921506D17Rik, 3110082M05Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74351
Homologene: 3542
Efr3a
Name: EFR3 homolog A
Synonyms: A130089M23Rik, D030063F01Rik, C920006C10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76740
Homologene: 44222
Comp
Name: cartilage oligomeric matrix protein
Synonyms: thrombospondin-5, TSP5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12845
HGNC: HGNC:2227
Homologene: 74
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 40,548,643 bp
  • G to T, chromosome 1 at 63,585,427 bp
  • T to A, chromosome 1 at 92,479,848 bp
  • T to C, chromosome 1 at 173,906,203 bp
  • T to C, chromosome 2 at 31,010,544 bp
  • G to T, chromosome 2 at 36,850,273 bp
  • A to T, chromosome 2 at 66,504,849 bp
  • T to A, chromosome 2 at 86,413,216 bp
  • AAGAAAACTGAAAATCAT to A, chromosome 2 at 98,667,034 bp
  • G to A, chromosome 2 at 130,395,062 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to G, chromosome 3 at 55,128,276 bp
  • A to T, chromosome 4 at 116,816,956 bp
  • T to A, chromosome 4 at 117,307,590 bp
  • A to T, chromosome 5 at 51,472,922 bp
  • A to C, chromosome 5 at 72,735,193 bp
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp
  • A to T, chromosome 5 at 109,675,756 bp
  • A to G, chromosome 5 at 150,558,510 bp
  • T to G, chromosome 6 at 35,194,576 bp
  • A to T, chromosome 6 at 41,534,030 bp
  • A to T, chromosome 6 at 87,811,366 bp
  • C to T, chromosome 7 at 41,649,625 bp
  • A to T, chromosome 7 at 66,849,799 bp
  • C to T, chromosome 7 at 98,123,878 bp
  • A to T, chromosome 7 at 99,767,596 bp
  • C to A, chromosome 7 at 128,183,108 bp
  • C to T, chromosome 8 at 40,797,070 bp
  • G to A, chromosome 8 at 70,373,853 bp
  • G to T, chromosome 8 at 71,890,840 bp
  • A to G, chromosome 8 at 94,069,997 bp
  • T to A, chromosome 8 at 107,001,637 bp
  • A to T, chromosome 8 at 111,160,735 bp
  • C to T, chromosome 9 at 5,321,318 bp
  • T to C, chromosome 9 at 13,245,501 bp
  • A to G, chromosome 9 at 38,108,968 bp
  • A to G, chromosome 10 at 19,609,183 bp
  • A to T, chromosome 10 at 79,760,892 bp
  • T to C, chromosome 10 at 80,253,785 bp
  • ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT to ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT, chromosome 10 at 80,804,437 bp
  • T to A, chromosome 10 at 89,327,276 bp
  • A to T, chromosome 11 at 33,203,058 bp
  • A to G, chromosome 11 at 61,791,432 bp
  • A to G, chromosome 11 at 67,665,391 bp
  • A to T, chromosome 11 at 69,399,952 bp
  • A to C, chromosome 11 at 73,815,100 bp
  • A to T, chromosome 11 at 115,256,237 bp
  • A to C, chromosome 11 at 120,809,235 bp
  • T to A, chromosome 12 at 16,819,057 bp
  • A to G, chromosome 12 at 64,472,563 bp
  • A to G, chromosome 12 at 102,484,422 bp
  • T to C, chromosome 12 at 112,779,125 bp
  • T to C, chromosome 13 at 119,699,963 bp
  • A to T, chromosome 14 at 4,711,357 bp
  • T to A, chromosome 15 at 65,861,740 bp
  • C to T, chromosome 15 at 86,144,719 bp
  • T to C, chromosome 15 at 98,648,623 bp
  • C to A, chromosome 15 at 101,564,883 bp
  • C to CTAG, chromosome 16 at 32,754,078 bp
  • T to G, chromosome 17 at 39,539,977 bp
  • T to G, chromosome 17 at 50,606,803 bp
  • T to C, chromosome 17 at 80,406,838 bp
  • T to A, chromosome 18 at 7,921,560 bp
  • A to G, chromosome 18 at 70,568,877 bp
  • A to G, chromosome 18 at 74,731,754 bp
  • G to A, chromosome 19 at 13,479,655 bp
  • G to T, chromosome 19 at 39,842,990 bp
  • AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG to AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG, chromosome X at 73,640,522 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7930 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045977-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.