Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8005Btlr/Mmmh
Stock Number:
046045-MU
Citation ID:
RRID:MMRRC_046045-MU
Other Names:
R8005 (G1)
Major Collection:

Strain Information

B4galt5
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Synonyms: 9430078I07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56336
HGNC: HGNC:928
Homologene: 3507
Pax2
Name: paired box 2
Synonyms: Pax-2, Opdc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18504
HGNC: HGNC:8616
Homologene: 2968
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Dscaml1
Name: DS cell adhesion molecule like 1
Synonyms: 4930435C18Rik, 4921507G06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114873
VEGA: 9
Homologene: 79549
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Ticrr
Name: TOPBP1-interacting checkpoint and replication regulator
Synonyms: 5730590G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77011
Homologene: 67120
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 22,412,213 bp
  • T to A, chromosome 1 at 75,505,452 bp
  • A to G, chromosome 2 at 21,211,944 bp
  • A to T, chromosome 2 at 28,712,302 bp
  • A to G, chromosome 2 at 36,850,144 bp
  • A to T, chromosome 2 at 60,332,934 bp
  • G to A, chromosome 2 at 104,258,254 bp
  • T to C, chromosome 2 at 105,127,444 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to G, chromosome 2 at 167,301,464 bp
  • T to A, chromosome 3 at 55,117,352 bp
  • A to G, chromosome 4 at 12,047,821 bp
  • A to G, chromosome 4 at 101,837,251 bp
  • G to A, chromosome 4 at 107,209,491 bp
  • T to A, chromosome 4 at 139,412,630 bp
  • T to C, chromosome 5 at 92,428,147 bp
  • A to G, chromosome 5 at 145,195,758 bp
  • T to A, chromosome 6 at 30,896,697 bp
  • A to T, chromosome 6 at 139,622,069 bp
  • T to C, chromosome 7 at 13,261,138 bp
  • T to C, chromosome 7 at 30,436,045 bp
  • T to G, chromosome 7 at 79,694,048 bp
  • C to A, chromosome 7 at 84,003,408 bp
  • T to C, chromosome 7 at 108,032,263 bp
  • T to C, chromosome 7 at 108,465,486 bp
  • T to C, chromosome 7 at 116,418,036 bp
  • T to C, chromosome 7 at 126,469,307 bp
  • C to T, chromosome 9 at 4,330,655 bp
  • G to T, chromosome 9 at 45,717,510 bp
  • T to A, chromosome 9 at 50,538,913 bp
  • A to T, chromosome 9 at 73,015,264 bp
  • C to T, chromosome 9 at 92,490,790 bp
  • A to G, chromosome 9 at 110,856,076 bp
  • T to A, chromosome 10 at 88,971,321 bp
  • G to A, chromosome 10 at 98,994,799 bp
  • A to T, chromosome 11 at 5,061,552 bp
  • A to G, chromosome 11 at 48,866,390 bp
  • G to T, chromosome 11 at 49,318,141 bp
  • A to T, chromosome 11 at 73,712,314 bp
  • A to T, chromosome 11 at 77,045,786 bp
  • A to T, chromosome 12 at 8,009,744 bp
  • T to G, chromosome 12 at 8,539,395 bp
  • A to G, chromosome 12 at 69,185,948 bp
  • A to G, chromosome 12 at 84,017,000 bp
  • T to C, chromosome 12 at 107,916,197 bp
  • C to T, chromosome 13 at 3,575,681 bp
  • T to A, chromosome 13 at 40,719,208 bp
  • C to A, chromosome 13 at 92,438,722 bp
  • T to A, chromosome 14 at 72,426,400 bp
  • T to C, chromosome 14 at 108,913,265 bp
  • C to T, chromosome 15 at 77,718,077 bp
  • A to G, chromosome 15 at 89,294,205 bp
  • T to C, chromosome 16 at 45,532,037 bp
  • G to A, chromosome 16 at 77,077,068 bp
  • T to A, chromosome 17 at 23,344,150 bp
  • G to A, chromosome 17 at 24,599,596 bp
  • A to G, chromosome 17 at 28,059,367 bp
  • T to C, chromosome 17 at 46,890,760 bp
  • T to C, chromosome 19 at 6,080,477 bp
  • G to A, chromosome 19 at 44,760,889 bp
  • C to T, chromosome Y at 2,663,303 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8005 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046045-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.