Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8005Btlr/Mmmh
Stock Number:
046045-MU
Citation ID:
RRID:MMRRC_046045-MU
Other Names:
R8005 (G1)
Major Collection:

Strain Information

B4galt5
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Synonyms: 9430078I07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56336
HGNC: HGNC:928
Homologene: 3507
Pax2
Name: paired box 2
Synonyms: Pax-2, Opdc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18504
HGNC: HGNC:8616
Homologene: 2968
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Dscaml1
Name: DS cell adhesion molecule like 1
Synonyms: 4930435C18Rik, 4921507G06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114873
VEGA: 9
Homologene: 79549
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Ticrr
Name: TOPBP1-interacting checkpoint and replication regulator
Synonyms: 5730590G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77011
Homologene: 67120
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Atp2b1
Name: ATPase, Ca++ transporting, plasma membrane 1
Synonyms: PMCA1, E130111D10Rik, 2810442I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67972
VEGA: 10
HGNC: HGNC:814
Homologene: 55597
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Gas2l1
Name: growth arrest-specific 2 like 1
Synonyms: TU-71.1, D0Jmb1, GAR22, 4930500E24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78926
Homologene: 4733
Ankrd34b
Name: ankyrin repeat domain 34B
Synonyms: 6430502M16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218440
Homologene: 18450
Sbf1
Name: SET binding factor 1
Synonyms: 2610510A08Rik, Mtmr5, B230113C15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77980
Homologene: 84710
Tfap2a
Name: transcription factor AP-2, alpha
Synonyms: Ap-2 (a), AP-2 alpha, Ap2tf, Ap2, Tcfap2a, AP2alpha
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21418
VEGA: 13
Homologene: 2421
Cemip
Name: cell migration inducing protein, hyaluronan binding
Synonyms: 12H19.01.T7, 6330404C01Rik, 9930013L23Rik, Hybid
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80982
Homologene: 10268
Copg2
Name: coatomer protein complex, subunit gamma 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54160
HGNC: HGNC:2237
Homologene: 56292
Nup54
Name: nucleoporin 54
Synonyms: 3110079L04Rik, 54kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269113
Homologene: 41169
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Slitrk1
Name: SLIT and NTRK-like family, member 1
Synonyms: 3200001I04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76965
VEGA: 14
Homologene: 14174
Tsc2
Name: TSC complex subunit 2
Synonyms: tuberin, Nafld, tuberous sclerosis 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22084
VEGA: 17
Homologene: 462
Ano4
Name: anoctamin 4
Synonyms: A330096O15Rik, Tmem16d
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320091
Homologene: 66599
Pik3c2g
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18705
HGNC: HGNC:8973
Homologene: 3362
Prss46
Name: serine protease 46
Synonyms: 1700112C13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74306
Homologene: 77706
Aplp1
Name: amyloid beta precursor like protein 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11803
HGNC: HGNC:597
Homologene: 68447
Vmn2r115
Name: vomeronasal 2, receptor 115
Synonyms: EG638102, V2Rp4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638102
Homologene: 86604
D430041D05Rik
Name: RIKEN cDNA D430041D05 gene
Synonyms: G2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241589
Homologene: 115928
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116837
Homologene: 128399
Ly75
Name: lymphocyte antigen 75
Synonyms: DEC-205, CD205
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17076
Homologene: 31085
Bcl11b
Name: B cell leukemia/lymphoma 11B
Synonyms: COUP-TF interacting protein 2, CTIP2, B630002E05Rik, Rit1, 9130430L19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 58208
Homologene: 10974
Acot1
Name: acyl-CoA thioesterase 1
Synonyms: D12Ucla1, CTE-1, ACH2, CTE-I, Cte1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26897
VEGA: 12
Homologene: 22686
Zfp735
Name: zinc finger protein 735
Synonyms: 1700012C15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76390
Homologene: 88945
Pramel17
Name: PRAME like 17
Synonyms: B020004J07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545662
Homologene: 128627
Wt1
Name: WT1 transcription factor
Synonyms: Wt-1, D630046I19Rik, Wilms tumor 1 homolog
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22431
Homologene: 11536
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: Irip, SH2-Bb, SH2-B, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Or5p73
Name: olfactory receptor family 5 subfamily P member 73
Synonyms: GA_x6K02T2PBJ9-10795522-10796514, MOR204-36, Olfr498
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258304
Homologene: 133600
Kbtbd3
Name: kelch repeat and BTB (POZ) domain containing 3
Synonyms: 2200003A07Rik, Bklhd3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69149
Homologene: 12300
Tmem67
Name: transmembrane protein 67
Synonyms: 5330408M12Rik, b2b1291.1Clo, b2b1163.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329795
Homologene: 71886
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 21674
Or1j4
Name: olfactory receptor family 1 subfamily J member 4
Synonyms: GA_x6K02T2NLDC-33544602-33545540, MOR136-13, Olfr350
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258620
Homologene: 64897
Plscr4
Name: phospholipid scramblase 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235527
Homologene: 23217
Ak8
Name: adenylate kinase 8
Synonyms: 1190002A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68870
Homologene: 17622
Slc7a15
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 15
Synonyms: 2010001P20Rik, Arpat, 9030221C07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328059
Homologene: 77627
Ldlrad1
Name: low density lipoprotein receptor class A domain containing 1
Synonyms: OTTMUSG00000008594
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 546840
Homologene: 54473
Irgm1
Name: immunity-related GTPase family M member 1
Synonyms: LRG-47, Iigp3, Ifi1, Irgm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15944
Homologene: 134089
Bco2
Name: beta-carotene oxygenase 2
Synonyms: beta-diox-II, B-diox-II, CMO2, Bcdo2, Bcmo2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 170752
Homologene: 12912
Mgat2
Name: mannoside acetylglucosaminyltransferase 2
Synonyms: GNT-II, CDGS2, GNT2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217664
HGNC: HGNC:7045
Homologene: 1806
Zswim9
Name: zinc finger SWIM-type containing 9
Synonyms: 6330408A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 321008
Homologene: 52386
Or2y1b
Name: olfactory receptor family 2 subfamily Y member 1B
Synonyms: GA_x6K02T2QP88-6117098-6116163, MOR256-55, L45, Olfr10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18307
Homologene: 81347
Or5p6
Name: olfactory receptor family 5 subfamily P member 6
Synonyms: GA_x6K02T2PBJ9-10361879-10360935, MOR204-13, Olfr478
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258729
Homologene: 128076
Thnsl1
Name: threonine synthase-like 1 (bacterial)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208967
Homologene: 32609
Apol7e
Name: apolipoprotein L 7e
Synonyms: ENSMUSG00000071716
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666348
VEGA: 15
Homologene: 40940
Zkscan14
Name: zinc finger with KRAB and SCAN domains 14
Synonyms: 2810437E14Rik, 2310046C23Rik, Zfp99
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67235
Homologene: 11342
Pigb
Name: phosphatidylinositol glycan anchor biosynthesis, class B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 55981
HGNC: HGNC:8959
Homologene: 3570
Tbcc
Name: tubulin-specific chaperone C
Synonyms: 2810055C19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72726
VEGA: 17
Homologene: 2402
Tmem262
Name: transmembrane protein 262
Synonyms: BC048609
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433215
Homologene: 104835
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Cd200l2
Name: CD200 molecule like 2
Synonyms: Gm17783, iSEC2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100047671
VEGA: 16
Homologene: 86707
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 22,412,213 bp
  • T to A, chromosome 1 at 75,505,452 bp
  • A to G, chromosome 2 at 21,211,944 bp
  • A to T, chromosome 2 at 28,712,302 bp
  • A to G, chromosome 2 at 36,850,144 bp
  • A to T, chromosome 2 at 60,332,934 bp
  • G to A, chromosome 2 at 104,258,254 bp
  • T to C, chromosome 2 at 105,127,444 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to G, chromosome 2 at 167,301,464 bp
  • T to A, chromosome 3 at 55,117,352 bp
  • A to G, chromosome 4 at 12,047,821 bp
  • A to G, chromosome 4 at 101,837,251 bp
  • G to A, chromosome 4 at 107,209,491 bp
  • T to A, chromosome 4 at 139,412,630 bp
  • T to C, chromosome 5 at 92,428,147 bp
  • A to G, chromosome 5 at 145,195,758 bp
  • T to A, chromosome 6 at 30,896,697 bp
  • A to T, chromosome 6 at 139,622,069 bp
  • T to C, chromosome 7 at 13,261,138 bp
  • T to C, chromosome 7 at 30,436,045 bp
  • T to G, chromosome 7 at 79,694,048 bp
  • C to A, chromosome 7 at 84,003,408 bp
  • T to C, chromosome 7 at 108,032,263 bp
  • T to C, chromosome 7 at 108,465,486 bp
  • T to C, chromosome 7 at 116,418,036 bp
  • T to C, chromosome 7 at 126,469,307 bp
  • C to T, chromosome 9 at 4,330,655 bp
  • G to T, chromosome 9 at 45,717,510 bp
  • T to A, chromosome 9 at 50,538,913 bp
  • A to T, chromosome 9 at 73,015,264 bp
  • C to T, chromosome 9 at 92,490,790 bp
  • A to G, chromosome 9 at 110,856,076 bp
  • T to A, chromosome 10 at 88,971,321 bp
  • G to A, chromosome 10 at 98,994,799 bp
  • A to T, chromosome 11 at 5,061,552 bp
  • A to G, chromosome 11 at 48,866,390 bp
  • G to T, chromosome 11 at 49,318,141 bp
  • A to T, chromosome 11 at 73,712,314 bp
  • A to T, chromosome 11 at 77,045,786 bp
  • A to T, chromosome 12 at 8,009,744 bp
  • T to G, chromosome 12 at 8,539,395 bp
  • A to G, chromosome 12 at 69,185,948 bp
  • A to G, chromosome 12 at 84,017,000 bp
  • T to C, chromosome 12 at 107,916,197 bp
  • C to T, chromosome 13 at 3,575,681 bp
  • T to A, chromosome 13 at 40,719,208 bp
  • C to A, chromosome 13 at 92,438,722 bp
  • T to A, chromosome 14 at 72,426,400 bp
  • T to C, chromosome 14 at 108,913,265 bp
  • C to T, chromosome 15 at 77,718,077 bp
  • A to G, chromosome 15 at 89,294,205 bp
  • T to C, chromosome 16 at 45,532,037 bp
  • G to A, chromosome 16 at 77,077,068 bp
  • T to A, chromosome 17 at 23,344,150 bp
  • G to A, chromosome 17 at 24,599,596 bp
  • A to G, chromosome 17 at 28,059,367 bp
  • T to C, chromosome 17 at 46,890,760 bp
  • T to C, chromosome 19 at 6,080,477 bp
  • G to A, chromosome 19 at 44,760,889 bp
  • C to T, chromosome Y at 2,663,303 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8005 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046045-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.