Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8011Btlr/Mmmh
Stock Number:
046051-MU
Citation ID:
RRID:MMRRC_046051-MU
Other Names:
R8011 (G1)
Major Collection:

Strain Information

Pou2f1
Name: POU domain, class 2, transcription factor 1
Synonyms: Oct-1C, Oct-1B, Oct-1A, oct-1, Otf-1, Otf1, 2810482H01Rik, Oct-1z, Oct1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18986
HGNC: HGNC:9212
Homologene: 37658
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Gpr6
Name: G protein-coupled receptor 6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140741
VEGA: 10
HGNC: HGNC:4515
Homologene: 38026
Gaa
Name: glucosidase, alpha, acid
Synonyms: E430018M07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14387
HGNC: HGNC:4065
Homologene: 37268
Mok
Name: MOK protein kinase
Synonyms: MOK, MAPK/MAK/MRK/ overlapping kinase, Rage, Stk30
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26448
HGNC: HGNC:9833
Homologene: 8062
Igf2bp2
Name: insulin-like growth factor 2 mRNA binding protein 2
Synonyms: IMP-2, C330012H03Rik, IMP2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 319765
Homologene: 4774
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 92,491,275 bp
  • T to A, chromosome 1 at 107,434,757 bp
  • A to G, chromosome 1 at 133,263,806 bp
  • T to C, chromosome 1 at 154,465,822 bp
  • A to G, chromosome 1 at 165,894,903 bp
  • G to A, chromosome 2 at 27,980,521 bp
  • A to T, chromosome 2 at 71,875,452 bp
  • T to G, chromosome 2 at 85,823,613 bp
  • A to C, chromosome 2 at 87,048,846 bp
  • G to A, chromosome 2 at 88,683,193 bp
  • A to G, chromosome 2 at 150,192,346 bp
  • T to C, chromosome 2 at 155,555,957 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • T to G, chromosome 3 at 57,807,070 bp
  • T to C, chromosome 3 at 146,422,911 bp
  • A to G, chromosome 3 at 154,247,810 bp
  • T to C, chromosome 4 at 132,998,479 bp
  • T to C, chromosome 4 at 152,287,481 bp
  • A to G, chromosome 5 at 25,351,234 bp
  • G to C, chromosome 6 at 18,426,093 bp
  • T to C, chromosome 6 at 41,313,487 bp
  • A to T, chromosome 6 at 102,437,899 bp
  • A to G, chromosome 6 at 123,396,410 bp
  • A to G, chromosome 6 at 146,868,135 bp
  • T to A, chromosome 7 at 27,818,715 bp
  • T to C, chromosome 7 at 35,616,881 bp
  • G to A, chromosome 7 at 75,730,465 bp
  • T to A, chromosome 7 at 139,910,620 bp
  • G to T, chromosome 8 at 18,948,720 bp
  • T to C, chromosome 8 at 110,583,909 bp
  • C to A, chromosome 9 at 57,713,376 bp
  • C to T, chromosome 9 at 124,293,899 bp
  • T to C, chromosome 10 at 31,332,917 bp
  • T to A, chromosome 10 at 41,070,915 bp
  • G to T, chromosome 11 at 21,275,095 bp
  • C to T, chromosome 11 at 119,272,936 bp
  • A to G, chromosome 12 at 83,116,292 bp
  • T to C, chromosome 12 at 110,814,917 bp
  • A to T, chromosome 13 at 11,588,140 bp
  • A to T, chromosome 15 at 7,247,044 bp
  • A to T, chromosome 16 at 22,076,099 bp
  • C to T, chromosome 16 at 32,668,365 bp
  • G to A, chromosome 16 at 35,856,634 bp
  • T to C, chromosome 17 at 3,448,396 bp
  • G to A, chromosome 17 at 71,230,375 bp
  • T to C, chromosome 17 at 85,687,672 bp
  • T to C, chromosome 19 at 46,081,584 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8011 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046051-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.