Loading Mouse GIF
Loading...

Strain Name:
FVB/NOve-Trp53em3Ove/Mmmh
Stock Number:
065578-MU
Citation ID:
RRID:MMRRC_065578-MU
Other Names:
Trp53 Gal4 insert

Strain Information

Trp53em3Ove
Name: transformation related protein 53; endonuclease-mediated mutation 3, Paul Overbeek
Type: Allele
Species: Multi-species
Chromosome: 11
Trp53
Name: transformation related protein 53
Synonyms: p53, p44
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22059
Homologene: 460
GAL4
Name: Gal4 yeast transcription activator protein
Type: Gene
Species: Saccharomyces cerevisiae (yeast)
Chromosome: 16
Genetic Alterations
Targeted in-frame insertion of the S. cerevisiae GAL4 DNA-binding domain (DBD) into exon 5 of Trp53. The goal was to insert the GAL4 DBD into the DBD of p53, thereby generating a modified version of p53 that binds transgenes with UAS-containing promoter sequences to drive tumor-specific expression of the transgenes.

HGVS nomenclature:
  • Genbank RefSeq - mRNA: NM_011640.3
  • Genbank RefSeq, protein: NP_035770.2
  • Variant, nucleic acid level: c.499_500ins(297)
    (TGGACTCCCAGCAGCCAGATCTGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATGATTTTGAAAATGGATTCTTTACAGGATATAAAAGCATTGT)
  • Variant, amino acid level, predicted: p.Thr167delins(99)
    (MDSQQPDLKLLSSIEQACDICRLKKLKCSKEKPKCAKCLKNNWECRYSPKTKRSPLTRAHLTEVESRLERLEQLFLLIFPREDLDMILKMDSLQDIKAL)
  • Check this variant: LUMC Mutalyzer
Genotype Determination
Phenotype
Only one mouse has been phenotyped, showing hemangiosarcomas at 8 weeks of age, as expected since the DNA-binding domain of p53had been disrupted by the GAL4 insertion. The donor predicted that the resulting p53 protein would drive the expression of coding sequences that are linked to a minimal promoter containing the binding sequences for GAL4 (termed UAS). The p53/GAL4 chimeric protein is expected to be stable and transported to the nucleus in tumor cells, thereby allowing tumor-specific expression of reporter genes or anti-tumor genes.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Cancer therapy
Donor
Paul Overbeek, Ph.D., Baylor College of Medicine.
Strain Development
Embryo injections were done with one guide RNA. The target sequence for the guide RNA was GAAGTCACAGCACATGACGG (agg), which is located in exon 5 of Trp53. The following oligos were used to amplify the DNA-binding domain (DBD) of the GAL4 transcription factor (template plasmid provided by the lab of Ming Tsai) for in-frame insertion into the DBD of p53:

  • Sense oligo: 5’- ccatgg ccatctacaa GAAGTCACAG CAC ATG Atg gac tcc cag cag cca gat ctg a
  • Antisense oligo: 5’- gctcatggtgggggcagcgtctcacgacctc cgA CAATGCTTTTATATCCTGTAA
The CRISPR guide RNA, Cas9 protein, and donor DNA were microinjected into the pronucleus of FVB zygotes. Progeny were screened by PCR using primers 825 (cttgacacctgatcgttactcgg) and 827 (gctgttccagtctttctagccttg) to look for targeted insertion of the Gal4 sequences. One founder male was mated to FVB females, and the F1 progeny were screened by PCR amplifications of tail DNA using primers 825+827, and primers 825+826 (gagcaagaataagtcagaagcc) to amplify the entire GAL4 insertion. The PCR bands were sequenced. One F1 male with the correct Gal4 sequences was mated to FVB females. Progeny were screened by PCR and sequencing.

Note: The FVB strain used during the development was transferred from the NIH to the donor's institution >34 years prior, thus establishing the substrain FVB/Ove.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
White
Eye
Pink
MMRRC Breeding System
Sib-mating
Generation
F2
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined Viability is expected to be similar to MMRRC:65575
Homozygotes are fertile: Undetermined Undetermined Likely to be similar to MMRRC:65575
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
No
Average litter size
5 to 9
Recommended wean age
3 weeks
Average Pups Weaned
5 to 9

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
065578-MU-EMBRYO Cryo-preserved embryos $1,038.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
065578-MU-SPERM Cryo-preserved spermatozoa $437.00 / Non-Profit Aliquot Approximate quantity3
065578-MU-RESUS Litter recovered from cryo-archive $2,697.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.