Strain Name:
C57BL/6J-MtgxR8039Btlr/Mmmh
Stock Number:
067476-MU
Citation ID:
RRID:MMRRC_067476-MU
Other Names:
R8039 (G1)
Major Collection:

Strain Information

Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Pik3cd
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms: p110delta, 2410099E07Rik, 2610208K16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18707
HGNC: HGNC:8977
Homologene: 3686
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Gtf2i
Name: general transcription factor II I
Synonyms: TFII-I, BAP-135, 6030441I21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Lims1
Name: LIM and senescent cell antigen-like domains 1
Synonyms: 2310016J22Rik, 4921524A02Rik, Lims1l, PINCH1, C430041B13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110829
HGNC: HGNC:6616
Homologene: 68428
Gck
Name: glucokinase
Synonyms: hexokinase 4, MODY2, HK4, Gls006, Hlb62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103988
HGNC: HGNC:4195
Homologene: 55440
Fbxo31
Name: F-box protein 31
Synonyms: 2310046N15Rik, Fbx14, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Miga1
Name: mitoguardin 1
Synonyms: C030011O14Rik, Fam73a, Mita1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 215708
Homologene: 18369
Kif15
Name: kinesin family member 15
Synonyms: N-10 kinesin, HKLP2, 3930402I10Rik, 3110023M17Rik, Knsl7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209737
VEGA: 9
Homologene: 23210
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Afdn
Name: afadin, adherens junction formation factor
Synonyms: AF6, Afadin, S-afadin, I-afadin, 5033403D15Rik, Mllt4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Pcp-1, Itpr-1, Ip3r, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192159
Homologene: 4706
Rraga
Name: Ras-related GTP binding A
Synonyms: 1300010C19Rik, FIP-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68441
Homologene: 68522
Ncapd2
Name: non-SMC condensin I complex, subunit D2
Synonyms: CNAP1, CAP-D2, 2810406C15Rik, 2810465G24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68298
Homologene: 6497
Slc30a5
Name: solute carrier family 30 (zinc transporter), member 5
Synonyms: Zntl1, ZnT-5, ZTL1, 1810010K08Rik, Znt5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69048
VEGA: 13
Homologene: 41503
Adgrb2
Name: adhesion G protein-coupled receptor B2
Synonyms: Bai2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230775
HGNC: HGNC:944
Homologene: 1288
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: RAB6IP2B, RAB6IP2A, 5033405M01Rik, B430107L16Rik, 9630025C19Rik, Rab6ip2, Elks1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 111173
Homologene: 14229
Cspp1
Name: centrosome and spindle pole associated protein 1
Synonyms: 4930413O22Rik, 2310020J12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211660
Homologene: 23487
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Rasa3
Name: RAS p21 protein activator 3
Synonyms: GAPIII activator 3, Ras GTPase-activating protein III, GAPIII, R-Ras gap, scat, hlb381
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19414
Homologene: 7217
Klrk1
Name: killer cell lectin-like receptor subfamily K, member 1
Synonyms: NKG2-D, Nkg2d, D6H12S2489E
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27007
Homologene: 7209
Coq7
Name: demethyl-Q 7
Synonyms: clk-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12850
HGNC: HGNC:2244
Homologene: 6953
Erh
Name: ERH mRNA splicing and mitosis factor
Synonyms: Mer, Prei1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13877
HGNC: HGNC:3447
Homologene: 3274
Ppp1r11
Name: protein phosphatase 1, regulatory inhibitor subunit 11
Synonyms: Tctex-5, HCG-V, HCGV, Tcte5, 1500041B02Rik, Tctex5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76497
HGNC: HGNC:9285
Homologene: 32520
Nadk
Name: NAD kinase
Synonyms: 4432404C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192185
Homologene: 49724
Ttyh1
Name: tweety family member 1
Synonyms: tty, 6330408P11Rik, 4930459B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57776
Homologene: 10779
Lhx8
Name: LIM homeobox protein 8
Synonyms: L3, Lhx7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16875
Homologene: 62661
Anpep
Name: alanyl aminopeptidase, membrane
Synonyms: Cd13, aminopeptidase N, Apn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16790
HGNC: HGNC:500
Homologene: 68163
Sf3a1
Name: splicing factor 3a, subunit 1
Synonyms: 1200014H24Rik, 5930416L09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67465
Homologene: 4294
Nphp3
Name: nephronophthisis 3 (adolescent)
Synonyms: D330020E01Rik, pcy, nephrocystin 3, 3632410F03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74025
HGNC: HGNC:7907
Homologene: 32697
Astl
Name: astacin like metalloendopeptidase
Synonyms: C87576, Ovastacin, Sas1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215095
Homologene: 128191
Chst10
Name: carbohydrate sulfotransferase 10
Synonyms: ST, Hnk-1st
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98388
Homologene: 21013
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Or8b50
Name: olfactory receptor family 8 subfamily B member 50
Synonyms: GA_x6K02T2PVTD-32308823-32309773, MOR165-7, Olfr914
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258782
VEGA: 9
Homologene: 115511
Fam124a
Name: family with sequence similarity 124, member A
Synonyms: EG629059
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 629059
Homologene: 86241
Fstl5
Name: follistatin-like 5
Synonyms: 9130207J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213262
Homologene: 10584
Trak2
Name: trafficking protein, kinesin binding 2
Synonyms: GRIF-1, CALS-C, OIP98, GRIF1, 4733401O11Rik, Als2cr3, 2900022D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70827
Homologene: 22861
Apoa4
Name: apolipoprotein A-IV
Synonyms: Apoa-4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11808
HGNC: HGNC:602
Homologene: 47927
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Slc6a18
Name: solute carrier family 6 (neurotransmitter transporter), member 18
Synonyms: XT2, D630001K16Rik, Xtrp2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22598
VEGA: 13
Homologene: 40785
Klhdc8a
Name: kelch domain containing 8A
Synonyms: A630065K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213417
Homologene: 10069
Madd
Name: MAP-kinase activating death domain
Synonyms: 9630059K23Rik, Rab3 GEP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228355
HGNC: HGNC:6766
Homologene: 14249
Prr29
Name: proline rich 29
Synonyms: 2310007L24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75573
Homologene: 130357
Poln
Name: DNA polymerase N
Synonyms: POL4P
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 272158
Homologene: 131253
Jakmip1
Name: janus kinase and microtubule interacting protein 1
Synonyms: Marlin-1, 5830437M04Rik, C330021K24Rik, Gababrbp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76071
Homologene: 90789
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 3830402K23Rik, 4930518F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320558
Homologene: 8604
Ecm2
Name: extracellular matrix protein 2, female organ and adipocyte specific
Synonyms: 9030618O22Rik, tenonectin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 407800
VEGA: 13
HGNC: HGNC:3154
Homologene: 1064
Atp2a1
Name: ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Synonyms: SERCA1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11937
HGNC: HGNC:811
Homologene: 7635
Or4c100
Name: olfactory receptor family 4 subfamily C member 100
Synonyms: GA_x6K02T2Q125-50012960-50013871, MOR230-5, Olfr1186
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258523
Homologene: 110555
Iqcm
Name: IQ motif containing M
Synonyms: 1700007B14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71831
Homologene: 53050
Ankrd60
Name: ankyrin repeat domain 60
Synonyms: 1700019A24Rik, 1700030G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70065
Homologene: 43792
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Mmp1a
Name: matrix metallopeptidase 1a (interstitial collagenase)
Synonyms: Mcol-A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83995
VEGA: 9
HGNC: HGNC:7155
Homologene: 20544
Cyp2c54
Name: cytochrome P450, family 2, subfamily c, polypeptide 54
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 404195
VEGA: 19
Homologene: 137231
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: EG381742, Zfp469
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231861
Homologene: 45603
Arhgef26
Name: Rho guanine nucleotide exchange factor 26
Synonyms: 8430436L14Rik, 4631416L12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 622434
Homologene: 9204
Daam2
Name: dishevelled associated activator of morphogenesis 2
Synonyms: 2310016D11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76441
VEGA: 17
Homologene: 69186
Vmn2r99
Name: vomeronasal 2, receptor 99
Synonyms: EG665376
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665376
Homologene: 115024
Usb1
Name: U6 snRNA biogenesis 1
Synonyms: AA960436
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 101985
Homologene: 11611
Ovgp1
Name: oviductal glycoprotein 1
Synonyms: MOGP, muc9, mucin 9, oviductin, Chit5, OGP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12659
HGNC: HGNC:8524
Homologene: 74442
Shank3
Name: SH3 and multiple ankyrin repeat domains 3
Synonyms: ProSAP2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 58234
Homologene: 75163
Epsti1
Name: epithelial stromal interaction 1
Synonyms: 5033415K03Rik, BRESI1, 2310046K10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 108670
VEGA: 14
Homologene: 12630
Pbld2
Name: phenazine biosynthesis-like protein domain containing 2
Synonyms: 3110049J23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67307
Gbp2b
Name: guanylate binding protein 2b
Synonyms: Mag-1, Mpa-1, Gbp-1, Mpa1, LIMIT, Gbp1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14468
Homologene: 137233
Ckmt2
Name: creatine kinase, mitochondrial 2
Synonyms: 2300008A19Rik, ScCKmit
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76722
HGNC: HGNC:1996
Homologene: 68206
Vmn1r84
Name: vomeronasal 1 receptor 84
Synonyms: V1rg11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171267
Homologene: 74328
Spaca1
Name: sperm acrosome associated 1
Synonyms: 1700124L11Rik, 4930540L03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67652
Homologene: 12170
Mau2
Name: MAU2 sister chromatid cohesion factor
Synonyms: A930019L04Rik, 9130404D08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74549
Homologene: 12574
Vsig1
Name: V-set and immunoglobulin domain containing 1
Synonyms: 1700062D20Rik, 4930405J24Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 78789
Homologene: 12703
Setdb2
Name: SET domain, bifurcated 2
Synonyms: LOC239122, KMT1F
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239122
Homologene: 12903
Gbp8
Name: guanylate-binding protein 8
Synonyms: 5830443L24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76074
Plat
Name: plasminogen activator, tissue
Synonyms: t-PA, tPA, D8Ertd2e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18791
HGNC: HGNC:9051
Homologene: 717
Nalf1
Name: NALCN channel auxiliary factor 1
Synonyms: Fam155a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270028
Homologene: 83472
Art1
Name: ADP-ribosyltransferase 1
Synonyms: ADPRT, Yac-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11870
HGNC: HGNC:723
Homologene: 128621
Rnf25
Name: ring finger protein 25
Synonyms: AO7, 0610009H16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 57751
Homologene: 11193
Mob3c
Name: MOB kinase activator 3C
Synonyms: MOB3C, D130076I06Rik, Mobkl2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100465
Homologene: 64826
Or6y1
Name: olfactory receptor family 6 subfamily Y member 1
Synonyms: GA_x6K02T2P20D-20731742-20730694, GA_x6K02SYWY4V-595-239, MOR103-13P, MOR103-17, EG546747, Olfr413-ps1, Olfr220
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 546747
Homologene: 67062
Fbxo3
Name: F-box protein 3
Synonyms: Fba, 1700026K02Rik, 1200002G09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57443
Homologene: 8133
Klhl38
Name: kelch-like 38
Synonyms: 8230402K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268807
Homologene: 18622
Agr2
Name: anterior gradient 2
Synonyms: mAG-2, Gob-4, XAG-2, HAG-2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23795
HGNC: HGNC:328
Homologene: 4674
Castor1
Name: cytosolic arginine sensor for mTORC1 subunit 1
Synonyms: 2410008K03Rik, Gatsl3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71962
Homologene: 81920
Iqcn
Name: IQ motif containing N
Synonyms: Gm16486
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 637079
Homologene: 141171
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 10,113,013 bp
  • T to A, chromosome 1 at 38,866,031 bp
  • T to C, chromosome 1 at 58,946,288 bp
  • T to C, chromosome 1 at 74,593,964 bp
  • G to A, chromosome 1 at 132,303,108 bp
  • T to A, chromosome 1 at 174,449,596 bp
  • T to A, chromosome 1 at 188,957,373 bp
  • T to A, chromosome 2 at 76,878,432 bp
  • C to T, chromosome 2 at 88,525,871 bp
  • T to A, chromosome 2 at 91,167,061 bp
  • T to A, chromosome 2 at 104,054,941 bp
  • A to T, chromosome 2 at 127,343,983 bp
  • A to T, chromosome 2 at 156,506,412 bp
  • C to A, chromosome 2 at 173,572,491 bp
  • C to T, chromosome 2 at 178,374,585 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • T to A, chromosome 3 at 36,943,214 bp
  • C to A, chromosome 3 at 62,339,930 bp
  • T to G, chromosome 3 at 76,648,418 bp
  • G to A, chromosome 3 at 87,977,008 bp
  • T to A, chromosome 3 at 105,976,023 bp
  • A to T, chromosome 3 at 142,618,164 bp
  • A to T, chromosome 3 at 152,276,756 bp
  • A to T, chromosome 3 at 154,306,939 bp
  • C to T, chromosome 4 at 34,044,207 bp
  • C to T, chromosome 4 at 86,575,980 bp
  • T to C, chromosome 4 at 115,831,687 bp
  • T to A, chromosome 4 at 130,022,268 bp
  • T to A, chromosome 4 at 149,659,866 bp
  • G to T, chromosome 4 at 155,577,067 bp
  • T to C, chromosome 4 at 156,169,011 bp
  • A to G, chromosome 5 at 34,122,672 bp
  • A to G, chromosome 5 at 37,100,772 bp
  • A to T, chromosome 5 at 105,050,917 bp
  • A to G, chromosome 5 at 134,255,834 bp
  • C to A, chromosome 5 at 142,732,052 bp
  • T to C, chromosome 6 at 91,070,233 bp
  • T to C, chromosome 6 at 108,386,628 bp
  • A to T, chromosome 6 at 119,773,665 bp
  • C to T, chromosome 6 at 125,181,026 bp
  • T to A, chromosome 6 at 129,612,823 bp
  • T to C, chromosome 7 at 4,122,541 bp
  • A to T, chromosome 7 at 12,362,008 bp
  • A to G, chromosome 7 at 79,839,400 bp
  • A to T, chromosome 7 at 102,106,845 bp
  • G to C, chromosome 7 at 118,533,246 bp
  • A to G, chromosome 7 at 126,448,805 bp
  • T to C, chromosome 8 at 9,207,892 bp
  • T to C, chromosome 8 at 13,588,931 bp
  • G to T, chromosome 8 at 22,772,232 bp
  • T to C, chromosome 8 at 70,019,790 bp
  • T to C, chromosome 8 at 70,710,906 bp
  • C to A, chromosome 8 at 75,763,105 bp
  • T to A, chromosome 8 at 95,333,413 bp
  • T to A, chromosome 8 at 121,559,055 bp
  • TG to TGG, chromosome 9 at 7,465,083 bp
  • T to A, chromosome 9 at 38,607,389 bp
  • A to T, chromosome 9 at 46,242,293 bp
  • T to C, chromosome 9 at 104,031,963 bp
  • T to A, chromosome 9 at 107,527,433 bp
  • A to T, chromosome 9 at 123,007,425 bp
  • T to A, chromosome 10 at 58,409,672 bp
  • T to A, chromosome 10 at 63,047,992 bp
  • C to T, chromosome 11 at 4,167,787 bp
  • G to T, chromosome 11 at 4,221,639 bp
  • C to T, chromosome 11 at 5,910,301 bp
  • T to A, chromosome 11 at 75,502,542 bp
  • C to T, chromosome 11 at 106,376,912 bp
  • A to T, chromosome 12 at 35,995,559 bp
  • A to G, chromosome 12 at 53,141,676 bp
  • T to A, chromosome 12 at 80,637,578 bp
  • A to T, chromosome 13 at 49,514,850 bp
  • T to C, chromosome 13 at 73,665,626 bp
  • G to A, chromosome 13 at 91,863,312 bp
  • A to G, chromosome 13 at 100,813,681 bp
  • T to A, chromosome 14 at 59,402,375 bp
  • C to T, chromosome 14 at 62,605,876 bp
  • G to A, chromosome 14 at 77,931,301 bp
  • T to C, chromosome 15 at 58,322,862 bp
  • A to T, chromosome 15 at 89,505,439 bp
  • T to C, chromosome 17 at 13,899,141 bp
  • T to C, chromosome 17 at 19,380,040 bp
  • T to C, chromosome 17 at 24,328,725 bp
  • T to C, chromosome 17 at 36,951,446 bp
  • C to A, chromosome 17 at 49,464,538 bp
  • CCTCTTTCATAGCTCT to CCTCT, chromosome 19 at 40,073,732 bp
  • C to T, chromosome X at 140,933,126 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8039 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067476-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.