Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8039Btlr/Mmmh
Stock Number:
067476-MU
Citation ID:
RRID:MMRRC_067476-MU
Other Names:
R8039 (G1)
Major Collection:

Strain Information

Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Pik3cd
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms: p110delta, 2410099E07Rik, 2610208K16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18707
HGNC: HGNC:8977
Homologene: 3686
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Gtf2i
Name: general transcription factor II I
Synonyms: TFII-I, BAP-135, 6030441I21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14886
HGNC: HGNC:4659
Homologene: 7748
Lims1
Name: LIM and senescent cell antigen-like domains 1
Synonyms: 2310016J22Rik, 4921524A02Rik, Lims1l, PINCH1, C430041B13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110829
HGNC: HGNC:6616
Homologene: 68428
Gck
Name: glucokinase
Synonyms: hexokinase 4, MODY2, HK4, Gls006, Hlb62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103988
HGNC: HGNC:4195
Homologene: 55440
Fbxo31
Name: F-box protein 31
Synonyms: 2310046N15Rik, Fbx14, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 10,113,013 bp
  • T to A, chromosome 1 at 38,866,031 bp
  • T to C, chromosome 1 at 58,946,288 bp
  • T to C, chromosome 1 at 74,593,964 bp
  • G to A, chromosome 1 at 132,303,108 bp
  • T to A, chromosome 1 at 174,449,596 bp
  • T to A, chromosome 1 at 188,957,373 bp
  • T to A, chromosome 2 at 76,878,432 bp
  • C to T, chromosome 2 at 88,525,871 bp
  • T to A, chromosome 2 at 91,167,061 bp
  • T to A, chromosome 2 at 104,054,941 bp
  • A to T, chromosome 2 at 127,343,983 bp
  • A to T, chromosome 2 at 156,506,412 bp
  • C to A, chromosome 2 at 173,572,491 bp
  • C to T, chromosome 2 at 178,374,585 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • T to A, chromosome 3 at 36,943,214 bp
  • C to A, chromosome 3 at 62,339,930 bp
  • T to G, chromosome 3 at 76,648,418 bp
  • G to A, chromosome 3 at 87,977,008 bp
  • T to A, chromosome 3 at 105,976,023 bp
  • A to T, chromosome 3 at 142,618,164 bp
  • A to T, chromosome 3 at 152,276,756 bp
  • A to T, chromosome 3 at 154,306,939 bp
  • C to T, chromosome 4 at 34,044,207 bp
  • C to T, chromosome 4 at 86,575,980 bp
  • T to C, chromosome 4 at 115,831,687 bp
  • T to A, chromosome 4 at 130,022,268 bp
  • T to A, chromosome 4 at 149,659,866 bp
  • G to T, chromosome 4 at 155,577,067 bp
  • T to C, chromosome 4 at 156,169,011 bp
  • A to G, chromosome 5 at 34,122,672 bp
  • A to G, chromosome 5 at 37,100,772 bp
  • A to T, chromosome 5 at 105,050,917 bp
  • A to G, chromosome 5 at 134,255,834 bp
  • C to A, chromosome 5 at 142,732,052 bp
  • T to C, chromosome 6 at 91,070,233 bp
  • T to C, chromosome 6 at 108,386,628 bp
  • A to T, chromosome 6 at 119,773,665 bp
  • C to T, chromosome 6 at 125,181,026 bp
  • T to A, chromosome 6 at 129,612,823 bp
  • T to C, chromosome 7 at 4,122,541 bp
  • A to T, chromosome 7 at 12,362,008 bp
  • A to G, chromosome 7 at 79,839,400 bp
  • A to T, chromosome 7 at 102,106,845 bp
  • G to C, chromosome 7 at 118,533,246 bp
  • A to G, chromosome 7 at 126,448,805 bp
  • T to C, chromosome 8 at 9,207,892 bp
  • T to C, chromosome 8 at 13,588,931 bp
  • G to T, chromosome 8 at 22,772,232 bp
  • T to C, chromosome 8 at 70,019,790 bp
  • T to C, chromosome 8 at 70,710,906 bp
  • C to A, chromosome 8 at 75,763,105 bp
  • T to A, chromosome 8 at 95,333,413 bp
  • T to A, chromosome 8 at 121,559,055 bp
  • TG to TGG, chromosome 9 at 7,465,083 bp
  • T to A, chromosome 9 at 38,607,389 bp
  • A to T, chromosome 9 at 46,242,293 bp
  • T to C, chromosome 9 at 104,031,963 bp
  • T to A, chromosome 9 at 107,527,433 bp
  • A to T, chromosome 9 at 123,007,425 bp
  • T to A, chromosome 10 at 58,409,672 bp
  • T to A, chromosome 10 at 63,047,992 bp
  • C to T, chromosome 11 at 4,167,787 bp
  • G to T, chromosome 11 at 4,221,639 bp
  • C to T, chromosome 11 at 5,910,301 bp
  • T to A, chromosome 11 at 75,502,542 bp
  • C to T, chromosome 11 at 106,376,912 bp
  • A to T, chromosome 12 at 35,995,559 bp
  • A to G, chromosome 12 at 53,141,676 bp
  • T to A, chromosome 12 at 80,637,578 bp
  • A to T, chromosome 13 at 49,514,850 bp
  • T to C, chromosome 13 at 73,665,626 bp
  • G to A, chromosome 13 at 91,863,312 bp
  • A to G, chromosome 13 at 100,813,681 bp
  • T to A, chromosome 14 at 59,402,375 bp
  • C to T, chromosome 14 at 62,605,876 bp
  • G to A, chromosome 14 at 77,931,301 bp
  • T to C, chromosome 15 at 58,322,862 bp
  • A to T, chromosome 15 at 89,505,439 bp
  • T to C, chromosome 17 at 13,899,141 bp
  • T to C, chromosome 17 at 19,380,040 bp
  • T to C, chromosome 17 at 24,328,725 bp
  • T to C, chromosome 17 at 36,951,446 bp
  • C to A, chromosome 17 at 49,464,538 bp
  • CCTCTTTCATAGCTCT to CCTCT, chromosome 19 at 40,073,732 bp
  • C to T, chromosome X at 140,933,126 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8039 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067476-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.