Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8054Btlr/Mmmh
Stock Number:
067491-MU
Citation ID:
RRID:MMRRC_067491-MU
Other Names:
R8054 (G1)
Major Collection:

Strain Information

Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Rcc2
Name: regulator of chromosome condensation 2
Synonyms: 2610529N02Rik, 2610510H01Rik, Td60
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 108911
Homologene: 10282
Srrm1
Name: serine/arginine repetitive matrix 1
Synonyms: SRm160
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 51796
Ccar1
Name: cell division cycle and apoptosis regulator 1
Synonyms: Carp1, 2610511G16Rik, 9430036H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67500
VEGA: 10
Homologene: 10086
Nup133
Name: nucleoporin 133
Synonyms: 4832420O05Rik, mermaid
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234865
Homologene: 32402
Zfp106
Name: zinc finger protein 106
Synonyms: Cd-1, H3a, sirm, Sh3bp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20402
Homologene: 40787
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 39,287,571 bp
  • C to A, chromosome 1 at 44,206,655 bp
  • T to C, chromosome 1 at 63,058,678 bp
  • A to T, chromosome 1 at 97,840,389 bp
  • T to C, chromosome 1 at 133,683,607 bp
  • A to T, chromosome 1 at 183,088,248 bp
  • A to T, chromosome 2 at 22,574,317 bp
  • A to G, chromosome 2 at 69,204,913 bp
  • A to T, chromosome 2 at 85,590,840 bp
  • T to A, chromosome 2 at 104,155,045 bp
  • A to T, chromosome 2 at 120,524,519 bp
  • A to T, chromosome 2 at 125,346,018 bp
  • A to G, chromosome 2 at 131,522,180 bp
  • A to G, chromosome 2 at 145,973,518 bp
  • A to T, chromosome 3 at 98,742,015 bp
  • A to T, chromosome 4 at 111,982,229 bp
  • A to T, chromosome 4 at 114,244,609 bp
  • T to A, chromosome 4 at 132,544,757 bp
  • A to T, chromosome 4 at 135,325,015 bp
  • A to T, chromosome 4 at 139,468,102 bp
  • G to A, chromosome 4 at 140,702,275 bp
  • T to C, chromosome 5 at 4,038,707 bp
  • A to G, chromosome 5 at 8,824,272 bp
  • C to T, chromosome 5 at 87,698,027 bp
  • A to G, chromosome 5 at 90,291,055 bp
  • T to A, chromosome 5 at 137,784,742 bp
  • A to G, chromosome 5 at 150,536,504 bp
  • A to T, chromosome 6 at 55,976,439 bp
  • T to C, chromosome 6 at 85,867,772 bp
  • A to G, chromosome 6 at 116,540,999 bp
  • C to T, chromosome 6 at 123,316,039 bp
  • A to G, chromosome 7 at 28,365,316 bp
  • A to G, chromosome 7 at 28,989,756 bp
  • C to T, chromosome 7 at 44,625,127 bp
  • A to T, chromosome 7 at 49,632,750 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • C to A, chromosome 7 at 96,729,346 bp
  • T to A, chromosome 7 at 114,552,084 bp
  • A to G, chromosome 7 at 140,770,958 bp
  • T to A, chromosome 7 at 141,645,481 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • T to C, chromosome 8 at 43,130,383 bp
  • T to A, chromosome 8 at 88,247,558 bp
  • C to G, chromosome 8 at 109,646,376 bp
  • T to C, chromosome 8 at 123,949,217 bp
  • T to C, chromosome 9 at 7,791,063 bp
  • T to C, chromosome 9 at 19,641,969 bp
  • C to A, chromosome 9 at 39,484,737 bp
  • T to C, chromosome 10 at 5,270,970 bp
  • T to C, chromosome 10 at 33,940,252 bp
  • G to A, chromosome 10 at 59,454,995 bp
  • A to G, chromosome 10 at 62,747,436 bp
  • A to G, chromosome 10 at 69,248,890 bp
  • G to A, chromosome 11 at 23,361,295 bp
  • T to A, chromosome 11 at 51,048,263 bp
  • T to C, chromosome 11 at 51,818,614 bp
  • G to A, chromosome 11 at 67,891,458 bp
  • A to G, chromosome 11 at 104,730,400 bp
  • A to G, chromosome 12 at 70,227,339 bp
  • A to T, chromosome 13 at 21,638,949 bp
  • A to G, chromosome 13 at 22,883,765 bp
  • A to G, chromosome 13 at 23,011,740 bp
  • C to T, chromosome 14 at 50,924,671 bp
  • A to T, chromosome 14 at 53,831,115 bp
  • A to G, chromosome 14 at 75,583,899 bp
  • C to T, chromosome 15 at 76,306,257 bp
  • A to T, chromosome 15 at 98,843,925 bp
  • A to G, chromosome 16 at 21,773,493 bp
  • T to C, chromosome 16 at 62,806,597 bp
  • C to A, chromosome 17 at 28,836,597 bp
  • T to A, chromosome 17 at 71,834,273 bp
  • T to G, chromosome 18 at 44,405,707 bp
  • T to A, chromosome 18 at 47,291,905 bp
  • C to A, chromosome 18 at 54,899,546 bp
  • C to T, chromosome 18 at 57,921,872 bp
  • A to T, chromosome 19 at 8,939,050 bp
  • T to G, chromosome 19 at 44,007,116 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8054 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067491-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.