Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8069Btlr/Mmmh
Stock Number:
067504-MU
Citation ID:
RRID:MMRRC_067504-MU
Other Names:
R8069 (G1)
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, NP-2, 1110048P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Cdh1
Name: cadherin 1
Synonyms: E-cadherin, Ecad, UM, uvomorulin, L-CAM, E-cad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Cd40
Name: CD40 antigen
Synonyms: Cd40, Bp50, p50, Tnfrsf5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21939
Homologene: 954
Cnot7
Name: CCR4-NOT transcription complex, subunit 7
Synonyms: Caf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18983
Homologene: 49011
Llgl2
Name: LLGL2 scribble cell polarity complex component
Synonyms: 9130006H11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217325
HGNC: HGNC:6629
Homologene: 3323
Enpp2
Name: ectonucleotide pyrophosphatase/phosphodiesterase 2
Synonyms: Autotaxin, Npps2, PD-Ialpha, Pdnp2, ATX
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18606
HGNC: HGNC:3357
Homologene: 4526
Prtg
Name: protogenin
Synonyms: A230098A12Rik, Igdcc5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235472
Homologene: 54453
Tdg
Name: thymine DNA glycosylase
Synonyms: Jza1, E130317C12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21665
Homologene: 2415
Dido1
Name: death inducer-obliterator 1
Synonyms: DIO-1, 6720461J16Rik, D130048F08Rik, Datf1, dido, C130092D22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23856
HGNC: HGNC:2680
Homologene: 34139
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Dennd2c
Name: DENN domain containing 2C
Synonyms: A930010I20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329727
Homologene: 19542
Ccnf
Name: cyclin F
Synonyms: CycF, Fbxo1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12449
VEGA: 17
HGNC: HGNC:1591
Homologene: 1335
Fnbp1
Name: formin binding protein 1
Synonyms: FBP1, FBP17, 2210010H06Rik, 1110057E06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14269
Homologene: 100983
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Mcm2
Name: minichromosome maintenance complex component 2
Synonyms: CDCL1, BM28, Mcmd2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17216
HGNC: HGNC:6944
Homologene: 3325
Fam171b
Name: family with sequence similarity 171, member B
Synonyms: D430039N05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241520
Homologene: 18462
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: C530005A01Rik, 6030465E24Rik, spastic paraplegia 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214585
Homologene: 41614
Tbc1d13
Name: TBC1 domain family, member 13
Synonyms: 2600014A06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70296
Homologene: 10068
Zfp931
Name: zinc finger protein 931
Synonyms: 2810021G02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 353208
Homologene: 136272
Oma1
Name: OMA1 zinc metallopeptidase
Synonyms: 2010001O09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67013
Homologene: 12070
Adam18
Name: a disintegrin and metallopeptidase domain 18
Synonyms: Adam27, Dtgn3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13524
HGNC: HGNC:196
Homologene: 74941
Canx
Name: calnexin
Synonyms: 1110069N15Rik, CNX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12330
HGNC: HGNC:1473
Homologene: 1324
Cenpe
Name: centromere protein E
Synonyms: N-7 kinesin, CENP-E, 312kDa, Kif10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Aasdhppt
Name: aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Synonyms: 2810407B07Rik, AASD-PPT, CGI-80, LYS5, LYS2, 2010309J24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67618
Homologene: 9130
Dnaja3
Name: DnaJ heat shock protein family (Hsp40) member A3
Synonyms: 1200003J13Rik, Tid-1, 1810053A11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 83945
Homologene: 36170
Tbc1d2
Name: TBC1 domain family, member 2
Synonyms: LOC381605, PARIS-1, PARIS1, A630005A06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381605
Homologene: 10190
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Zfp648
Name: zinc finger protein 648
Synonyms: LOC207678, Gm10178
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100503355
Homologene: 18996
Zfyve9
Name: zinc finger, FYVE domain containing 9
Synonyms: Madhip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230597
HGNC: HGNC:6775
Homologene: 3527
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Man2b1
Name: mannosidase 2, alpha B1
Synonyms: lysosomal alpha-mannosidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17159
HGNC: HGNC:6826
Homologene: 37322
Efcab7
Name: EF-hand calcium binding domain 7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230500
Homologene: 19952
Cdhr2
Name: cadherin-related family member 2
Synonyms: LOC268663, Pcdh24
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268663
Homologene: 134510
Cimap1a
Name: ciliary microtubule associated protein 1A
Synonyms: SHIPPO1, 1700011O04Rik, Odf3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69287
Homologene: 12306
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Adam5
Name: a disintegrin and metallopeptidase domain 5
Synonyms: tMDCII
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11499
HGNC: HGNC:212
Homologene: 49138
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Clcn4
Name: chloride channel, voltage-sensitive 4
Synonyms: Clc4-2, Clcn4-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12727
HGNC: HGNC:2022
Homologene: 68207
Jkamp
Name: JNK1/MAPK8-associated membrane protein
Synonyms: 1200003C05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104771
Homologene: 9524
Srms
Name: src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Synonyms: srm, A230069J08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20811
Homologene: 7957
Armc12
Name: armadillo repeat containing 12
Synonyms: 4930511I11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67645
Homologene: 12168
Plekhg6
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Synonyms: LOC213522
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213522
Homologene: 32395
Iqca1
Name: IQ motif containing with AAA domain 1
Synonyms: 4930585L22Rik, 4930465P12Rik, Iqca
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74918
Homologene: 49784
Grin3b
Name: glutamate receptor, ionotropic, NMDA3B
Synonyms: NR3B
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 170483
Homologene: 15606
Msl2
Name: MSL complex subunit 2
Synonyms: E130103E02Rik, Rnf184, Msl2l1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77853
Homologene: 10021
Neurl1b
Name: neuralized E3 ubiquitin protein ligase 1B
Synonyms: EG240055, Neur2, C230078M08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240055
Homologene: 35443
Ptx4
Name: pentraxin 4
Synonyms: 1110018H23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68509
VEGA: 17
Homologene: 19179
Ipp
Name: IAP promoted placental gene
Synonyms: D4Jhu8, Mipp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16351
HGNC: HGNC:6108
Homologene: 4309
Rap1b
Name: RAS related protein 1b
Synonyms: 2810443E11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215449
VEGA: 10
Homologene: 68719
Or10ag58
Name: olfactory receptor family 10 subfamily AG member 58
Synonyms: GA_x6K02T2Q125-48936945-48937901, GA_x6K02T2Q125-48935224-48935664, MOR264-24, MOR264-3, Olfr1125, Olfr1124
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259030
Homologene: 133660
Adad2
Name: adenosine deaminase domain containing 2
Synonyms: 4930403J07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75773
Homologene: 16392
Aup1
Name: ancient ubiquitous protein 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11993
HGNC: HGNC:891
Homologene: 7239
Adgra2
Name: adhesion G protein-coupled receptor A2
Synonyms: Tem5, 9530074E10Rik, 8430414O08Rik, Gpr124
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78560
Homologene: 13112
Fdxacb1
Name: ferredoxin-fold anticodon binding domain containing 1
Synonyms: D630004A14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382137
Homologene: 19813
Gatad1
Name: GATA zinc finger domain containing 1
Synonyms: 2810047M21Rik, 2310031E19Rik, B330017N08Rik, 8430439A17Rik, Odag, 9130430G15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67210
Homologene: 56916
Nkain2
Name: Na+/K+ transporting ATPase interacting 2
Synonyms: 6330571D19Rik, Tcba1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432450
Homologene: 65073
Sftpd
Name: surfactant associated protein D
Synonyms: SP-D, Sftp4, Sfpd
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20390
VEGA: 14
Homologene: 2272
Or5aq7
Name: olfactory receptor family 5 subfamily AQ member 7
Synonyms: GA_x6K02T2N869-1820-882, MOR172-3, Olfr259
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258766
Homologene: 106833
Defa3
Name: defensin, alpha, 3
Synonyms: Defcr-3, Defcr3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13237
HGNC: HGNC:2764
Homologene: 113382
Gm45140
Name: predicted gene 45140
Type: Gene
Species: Mouse
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 46,224,706 bp
  • C to T, chromosome 1 at 62,745,408 bp
  • A to G, chromosome 1 at 90,045,744 bp
  • A to T, chromosome 1 at 154,204,116 bp
  • A to T, chromosome 2 at 30,147,403 bp
  • A to T, chromosome 2 at 31,036,594 bp
  • CCAGCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGCAGC, chromosome 2 at 83,812,874 bp
  • A to G, chromosome 2 at 87,108,067 bp
  • A to T, chromosome 2 at 87,435,020 bp
  • C to T, chromosome 2 at 122,113,156 bp
  • A to T, chromosome 2 at 165,056,775 bp
  • T to C, chromosome 2 at 178,067,916 bp
  • T to C, chromosome 2 at 180,660,912 bp
  • T to A, chromosome 2 at 181,206,958 bp
  • T to C, chromosome 3 at 103,165,130 bp
  • G to A, chromosome 3 at 135,243,718 bp
  • T to G, chromosome 4 at 43,177,597 bp
  • A to C, chromosome 4 at 46,649,737 bp
  • T to A, chromosome 4 at 99,829,378 bp
  • A to T, chromosome 4 at 103,319,035 bp
  • T to A, chromosome 4 at 108,685,018 bp
  • T to G, chromosome 4 at 116,510,856 bp
  • T to C, chromosome 5 at 3,643,540 bp
  • T to A, chromosome 5 at 109,940,440 bp
  • C to T, chromosome 6 at 83,055,929 bp
  • T to C, chromosome 6 at 87,819,569 bp
  • T to C, chromosome 6 at 88,892,057 bp
  • T to C, chromosome 6 at 125,363,046 bp
  • T to C, chromosome 7 at 7,296,759 bp
  • G to A, chromosome 7 at 41,480,511 bp
  • A to G, chromosome 7 at 64,208,970 bp
  • G to T, chromosome 7 at 98,083,626 bp
  • A to T, chromosome 7 at 140,850,302 bp
  • T to G, chromosome 8 at 21,288,272 bp
  • A to G, chromosome 8 at 24,628,230 bp
  • C to T, chromosome 8 at 24,813,525 bp
  • T to C, chromosome 8 at 27,119,223 bp
  • T to C, chromosome 8 at 40,507,473 bp
  • A to G, chromosome 8 at 85,097,045 bp
  • C to T, chromosome 8 at 106,657,773 bp
  • T to C, chromosome 8 at 119,616,007 bp
  • T to A, chromosome 9 at 4,296,823 bp
  • T to A, chromosome 9 at 15,322,586 bp
  • T to G, chromosome 9 at 50,768,835 bp
  • T to C, chromosome 9 at 72,844,983 bp
  • T to C, chromosome 9 at 101,100,960 bp
  • A to G, chromosome 10 at 32,890,038 bp
  • G to A, chromosome 10 at 79,977,034 bp
  • A to T, chromosome 10 at 82,638,793 bp
  • A to C, chromosome 10 at 117,821,609 bp
  • T to G, chromosome 11 at 50,311,704 bp
  • T to C, chromosome 11 at 110,090,050 bp
  • T to A, chromosome 11 at 115,853,286 bp
  • C to T, chromosome 12 at 72,090,058 bp
  • A to T, chromosome 13 at 54,731,070 bp
  • T to C, chromosome 14 at 41,172,581 bp
  • T to A, chromosome 15 at 54,847,301 bp
  • T to C, chromosome 16 at 4,684,267 bp
  • A to T, chromosome 16 at 77,069,055 bp
  • G to A, chromosome 16 at 89,789,258 bp
  • A to G, chromosome 17 at 24,225,015 bp
  • T to C, chromosome 17 at 25,122,779 bp
  • G to T, chromosome 17 at 26,432,227 bp
  • A to T, chromosome 17 at 28,532,436 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8069 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067504-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.