Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8069Btlr/Mmmh
Stock Number:
067504-MU
Citation ID:
RRID:MMRRC_067504-MU
Other Names:
R8069 (G1)
Major Collection:

Strain Information

Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, NP-2, 1110048P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Cdh1
Name: cadherin 1
Synonyms: E-cadherin, Ecad, UM, uvomorulin, L-CAM, E-cad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Cd40
Name: CD40 antigen
Synonyms: Cd40, Bp50, p50, Tnfrsf5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21939
Homologene: 954
Cnot7
Name: CCR4-NOT transcription complex, subunit 7
Synonyms: Caf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18983
Homologene: 49011
Llgl2
Name: LLGL2 scribble cell polarity complex component
Synonyms: 9130006H11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217325
HGNC: HGNC:6629
Homologene: 3323
Enpp2
Name: ectonucleotide pyrophosphatase/phosphodiesterase 2
Synonyms: Autotaxin, Npps2, PD-Ialpha, Pdnp2, ATX
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18606
HGNC: HGNC:3357
Homologene: 4526
Prtg
Name: protogenin
Synonyms: A230098A12Rik, Igdcc5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235472
Homologene: 54453
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 46,224,706 bp
  • C to T, chromosome 1 at 62,745,408 bp
  • A to G, chromosome 1 at 90,045,744 bp
  • A to T, chromosome 1 at 154,204,116 bp
  • A to T, chromosome 2 at 30,147,403 bp
  • A to T, chromosome 2 at 31,036,594 bp
  • CCAGCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGCAGC, chromosome 2 at 83,812,874 bp
  • A to G, chromosome 2 at 87,108,067 bp
  • A to T, chromosome 2 at 87,435,020 bp
  • C to T, chromosome 2 at 122,113,156 bp
  • A to T, chromosome 2 at 165,056,775 bp
  • T to C, chromosome 2 at 178,067,916 bp
  • T to C, chromosome 2 at 180,660,912 bp
  • T to A, chromosome 2 at 181,206,958 bp
  • T to C, chromosome 3 at 103,165,130 bp
  • G to A, chromosome 3 at 135,243,718 bp
  • T to G, chromosome 4 at 43,177,597 bp
  • A to C, chromosome 4 at 46,649,737 bp
  • T to A, chromosome 4 at 99,829,378 bp
  • A to T, chromosome 4 at 103,319,035 bp
  • T to A, chromosome 4 at 108,685,018 bp
  • T to G, chromosome 4 at 116,510,856 bp
  • T to C, chromosome 5 at 3,643,540 bp
  • T to A, chromosome 5 at 109,940,440 bp
  • C to T, chromosome 6 at 83,055,929 bp
  • T to C, chromosome 6 at 87,819,569 bp
  • T to C, chromosome 6 at 88,892,057 bp
  • T to C, chromosome 6 at 125,363,046 bp
  • T to C, chromosome 7 at 7,296,759 bp
  • G to A, chromosome 7 at 41,480,511 bp
  • A to G, chromosome 7 at 64,208,970 bp
  • G to T, chromosome 7 at 98,083,626 bp
  • A to T, chromosome 7 at 140,850,302 bp
  • T to G, chromosome 8 at 21,288,272 bp
  • A to G, chromosome 8 at 24,628,230 bp
  • C to T, chromosome 8 at 24,813,525 bp
  • T to C, chromosome 8 at 27,119,223 bp
  • T to C, chromosome 8 at 40,507,473 bp
  • A to G, chromosome 8 at 85,097,045 bp
  • C to T, chromosome 8 at 106,657,773 bp
  • T to C, chromosome 8 at 119,616,007 bp
  • T to A, chromosome 9 at 4,296,823 bp
  • T to A, chromosome 9 at 15,322,586 bp
  • T to G, chromosome 9 at 50,768,835 bp
  • T to C, chromosome 9 at 72,844,983 bp
  • T to C, chromosome 9 at 101,100,960 bp
  • A to G, chromosome 10 at 32,890,038 bp
  • G to A, chromosome 10 at 79,977,034 bp
  • A to T, chromosome 10 at 82,638,793 bp
  • A to C, chromosome 10 at 117,821,609 bp
  • T to G, chromosome 11 at 50,311,704 bp
  • T to C, chromosome 11 at 110,090,050 bp
  • T to A, chromosome 11 at 115,853,286 bp
  • C to T, chromosome 12 at 72,090,058 bp
  • A to T, chromosome 13 at 54,731,070 bp
  • T to C, chromosome 14 at 41,172,581 bp
  • T to A, chromosome 15 at 54,847,301 bp
  • T to C, chromosome 16 at 4,684,267 bp
  • A to T, chromosome 16 at 77,069,055 bp
  • G to A, chromosome 16 at 89,789,258 bp
  • A to G, chromosome 17 at 24,225,015 bp
  • T to C, chromosome 17 at 25,122,779 bp
  • G to T, chromosome 17 at 26,432,227 bp
  • A to T, chromosome 17 at 28,532,436 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8069 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067504-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.