Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8110Btlr/Mmmh
Stock Number:
067539-MU
Citation ID:
RRID:MMRRC_067539-MU
Other Names:
R8110 (G1)
Major Collection:

Strain Information

Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Arfgef2
Name: ARF guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Hspa12a
Name: heat shock protein 12A
Synonyms: Hspa12a, 1700063D12Rik, Gm19925
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73442
VEGA: 19
Homologene: 18422
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Zfp568
Name: zinc finger protein 568
Synonyms: LOC381866, chato
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243905
Homologene: 136307
Eefsec
Name: eukaryotic elongation factor, selenocysteine-tRNA-specific
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 65967
Homologene: 11073
Mettl3
Name: methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit
Synonyms: 2310024F18Rik, Spo8, M6A
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56335
Homologene: 10501
Fto
Name: FTO alpha-ketoglutarate dependent dioxygenase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26383
Homologene: 8053
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Nfe2l2
Name: nuclear factor, erythroid derived 2, like 2
Synonyms: Nrf2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18024
HGNC: HGNC:7782
Homologene: 2412
Nbn
Name: nibrin
Synonyms: Nbs1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27354
HGNC: HGNC:7652
Homologene: 1858
Gabbr1
Name: gamma-aminobutyric acid type B receptor subunit 1
Synonyms: GABAbR1, GABAB1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54393
HGNC: HGNC:4070
Homologene: 1132
Galnt9
Name: polypeptide N-acetylgalactosaminyltransferase 9
Synonyms: GalNAc-T9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231605
HGNC: HGNC:4131
Homologene: 72793
Map3k1
Name: mitogen-activated protein kinase kinase kinase 1
Synonyms: MEKK1, Mekk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26401
HGNC: HGNC:6848
Homologene: 8056
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Gcnt2
Name: glucosaminyl (N-acetyl) transferase 2 (I blood group)
Synonyms: IGnTC, IGnTB, IGnTA, 5330430K10Rik, IGnT
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14538
VEGA: 13
HGNC: HGNC:4204
Homologene: 41535
Smad5
Name: SMAD family member 5
Synonyms: Smad 5, MusMLP, Madh5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17129
HGNC: HGNC:6771
Homologene: 4313
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 7330406P05Rik, 2900057D21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72993
Homologene: 32143
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Calcrl
Name: calcitonin receptor-like
Synonyms: CRLR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54598
Homologene: 21179
Sharpin
Name: SHANK-associated RH domain interacting protein
Synonyms: 0610041B22Rik, SIPL1, cpdm
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106025
Homologene: 11918
Kcnn3
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms: small conductance calcium-activated potassium channel 3, SK3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140493
HGNC: HGNC:6292
Homologene: 20516
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Or10aa3
Name: olfactory receptor family 10 subfamily AA member 3
Synonyms: GA_x6K02T2P20D-21124681-21123743, MOR123-2, Olfr432
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258711
Homologene: 81532
Gm10800
Name: predicted gene 10800
Type: Gene
Species: Mouse
Chromosome: 2
Usp50
Name: ubiquitin specific peptidase 50
Synonyms: 1700086G18Rik, 4930511O11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75083
Homologene: 75281
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Cfap69
Name: cilia and flagella associated protein 69
Synonyms: A330021E22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207686
Homologene: 11718
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234353
Homologene: 87257
Fem1b
Name: fem 1 homolog b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14155
VEGA: 9
HGNC: HGNC:3649
Homologene: 7714
Vmn2r5
Name: vomeronasal 2, receptor 5
Synonyms: EG667060
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 667060
Fmo9
Name: flavin containing monooxygenase 9
Synonyms: 4831428F09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240894
Homologene: 134192
Lmbrd2
Name: LMBR1 domain containing 2
Synonyms: 9930036E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320506
VEGA: 15
Homologene: 44696
Or1ak2
Name: olfactory receptor family 1 subfamily AK member 2
Synonyms: GA_x6K02T2NLDC-33631647-33632594, MOR134-1, Olfr356
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258617
Homologene: 85948
Sanbr
Name: SANT and BTB domain regulator of CSR
Synonyms: 0610010F05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71675
Homologene: 19038
Ncln
Name: nicalin
Synonyms: 3100002P13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103425
Homologene: 10604
Ceacam15
Name: CEA cell adhesion molecule 15
Synonyms: C430002N04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101434
Homologene: 131210
Gmcl1
Name: germ cell-less, spermatogenesis associated 1
Synonyms: mglc-1, 2810049L19Rik, Gcl, Btbd13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23885
Homologene: 8021
Prdm9
Name: PR domain containing 9
Synonyms: Meisetz, G1-419-29, Dsbc1, Rcr1, repro7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213389
Homologene: 104139
Zbbx
Name: zinc finger, B-box domain containing
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213234
Homologene: 11661
Tsen54
Name: tRNA splicing endonuclease subunit 54
Synonyms: 0610034P02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76265
Homologene: 35476
Itih2
Name: inter-alpha trypsin inhibitor, heavy chain 2
Synonyms: Intin2, Itih-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16425
HGNC: HGNC:6167
Homologene: 1668
Sox5
Name: SRY (sex determining region Y)-box 5
Synonyms: A730017D01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20678
Homologene: 21378
Hsd11b2
Name: hydroxysteroid 11-beta dehydrogenase 2
Synonyms: 11(beta)-HSD2, 11HSD2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15484
HGNC: HGNC:5209
Homologene: 20088
Or5w11
Name: olfactory receptor family 5 subfamily W member 11
Synonyms: GA_x6K02T2Q125-49133664-49134593, MOR177-4, Olfr1131
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258652
Homologene: 133019
Sphkap
Name: SPHK1 interactor, AKAP domain containing
Synonyms: A930009L15Rik, 4930544G21Rik, SKIP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77629
Homologene: 18172
Cyp2u1
Name: cytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms: 8430436A10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71519
Homologene: 77704
Mlip
Name: muscular LMNA-interacting protein
Synonyms: 2310046A06Rik, CIP, cardiac ISL1-interacting protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69642
Homologene: 90445
Proca1
Name: protein interacting with cyclin A1
Synonyms: 4933404M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216974
Homologene: 51856
Zfp28
Name: zinc finger protein 28
Synonyms: mkr-5, Zfp-28, 2810438M17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22690
Homologene: 69047
Krt6b
Name: keratin 6B
Synonyms: mK6[b], Krt2-6b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16688
VEGA: 15
Homologene: 136794
Cd200r3
Name: CD200 receptor 3
Synonyms: 4733401I18Rik, mCD200RLb, 4833409J19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74603
Or12d2
Name: olfactory receptor family 12 subfamily D member 2
Synonyms: MOR250-4, GA_x6K02T2PSCP-1775063-1774137, Olfr102
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258218
Homologene: 133728
Tcirg1
Name: T cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
Synonyms: V-ATPase a3, OC-116, TIRC7, ATP6a3, Atp6i
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 27060
Homologene: 4392
Pate7
Name: prostate and testis expressed 7
Synonyms: Gm17727
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100312986
Homologene: 129804
Tbx20
Name: T-box 20
Synonyms: Tbx12, 9430010M06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57246
VEGA: 9
Homologene: 32476
Ankrd45
Name: ankyrin repeat domain 45
Synonyms: 4933409K03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73844
Homologene: 19617
Tex36
Name: testis expressed 36
Synonyms: 4930404H21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73808
Homologene: 67014
Otop3
Name: otopetrin 3
Synonyms: 2310011E08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69602
Homologene: 26091
Rps18
Name: ribosomal protein S18
Synonyms: H2-Ke3, H-2Ke3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20084
Homologene: 88764
Lmf2
Name: lipase maturation factor 2
Synonyms: Tmem153, Tmem112b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105847
VEGA: 15
Homologene: 11251
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 83,278,771 bp
  • T to C, chromosome 1 at 161,151,319 bp
  • A to G, chromosome 1 at 166,663,526 bp
  • G to A, chromosome 1 at 174,050,525 bp
  • A to G, chromosome 2 at 10,097,137 bp
  • T to C, chromosome 2 at 36,937,709 bp
  • A to G, chromosome 2 at 69,506,453 bp
  • A to C, chromosome 2 at 75,679,421 bp
  • T to C, chromosome 2 at 82,958,673 bp
  • C to T, chromosome 2 at 84,339,339 bp
  • T to C, chromosome 2 at 87,628,607 bp
  • CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA to CAAGAAAACTGAAAATCA, chromosome 2 at 98,667,016 bp
  • T to A, chromosome 2 at 126,780,330 bp
  • T to A, chromosome 2 at 166,878,544 bp
  • A to T, chromosome 3 at 64,491,288 bp
  • T to C, chromosome 3 at 75,155,442 bp
  • T to A, chromosome 3 at 89,661,233 bp
  • G to A, chromosome 3 at 131,293,654 bp
  • T to C, chromosome 4 at 15,981,588 bp
  • T to A, chromosome 5 at 5,582,515 bp
  • A to G, chromosome 5 at 73,133,277 bp
  • G to T, chromosome 5 at 110,615,473 bp
  • A to G, chromosome 5 at 121,332,949 bp
  • T to C, chromosome 6 at 11,953,423 bp
  • G to T, chromosome 6 at 86,721,426 bp
  • A to C, chromosome 6 at 88,376,330 bp
  • C to T, chromosome 6 at 132,361,568 bp
  • T to C, chromosome 6 at 144,116,474 bp
  • T to A, chromosome 7 at 6,389,829 bp
  • A to G, chromosome 7 at 16,673,409 bp
  • G to T, chromosome 7 at 30,023,126 bp
  • T to A, chromosome 7 at 49,551,950 bp
  • G to A, chromosome 7 at 133,595,283 bp
  • T to A, chromosome 8 at 68,121,056 bp
  • T to C, chromosome 8 at 91,485,190 bp
  • A to G, chromosome 8 at 105,522,634 bp
  • T to A, chromosome 9 at 24,725,525 bp
  • T to C, chromosome 9 at 35,778,033 bp
  • T to C, chromosome 9 at 62,796,268 bp
  • G to T, chromosome 9 at 77,239,579 bp
  • T to A, chromosome 10 at 26,990,870 bp
  • A to T, chromosome 10 at 81,493,153 bp
  • G to T, chromosome 11 at 23,576,764 bp
  • A to G, chromosome 11 at 78,204,911 bp
  • A to T, chromosome 11 at 115,339,395 bp
  • G to T, chromosome 11 at 115,814,934 bp
  • A to G, chromosome 12 at 59,109,087 bp
  • A to T, chromosome 12 at 84,803,902 bp
  • G to T, chromosome 13 at 40,917,722 bp
  • C to A, chromosome 13 at 56,723,888 bp
  • A to G, chromosome 13 at 111,755,313 bp
  • C to A, chromosome 14 at 26,927,794 bp
  • G to T, chromosome 14 at 52,300,252 bp
  • T to A, chromosome 14 at 123,464,701 bp
  • T to C, chromosome 15 at 9,175,192 bp
  • G to A, chromosome 15 at 12,373,506 bp
  • T to A, chromosome 15 at 47,644,270 bp
  • C to A, chromosome 15 at 76,347,765 bp
  • C to G, chromosome 15 at 76,890,931 bp
  • C to T, chromosome 15 at 89,352,358 bp
  • G to A, chromosome 15 at 101,680,142 bp
  • T to A, chromosome 16 at 44,951,472 bp
  • T to A, chromosome 17 at 15,554,698 bp
  • A to G, chromosome 17 at 33,955,136 bp
  • G to C, chromosome 17 at 37,048,583 bp
  • A to G, chromosome 17 at 37,313,713 bp
  • A to C, chromosome 19 at 3,899,099 bp
  • G to A, chromosome 19 at 17,120,719 bp
  • T to A, chromosome 19 at 58,821,013 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8110 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067539-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.