Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8161Btlr/Mmmh
Stock Number:
067587-MU
Citation ID:
RRID:MMRRC_067587-MU
Other Names:
R8161 (G1)
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Mtg2
Name: mitochondrial ribosome associated GTPase 2
Synonyms: 1810011P19Rik, D2Bwg0647e, 2900056P18Rik, Gtpbp5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 52856
Homologene: 9233
Iffo2
Name: intermediate filament family orphan 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212632
Homologene: 102202
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 16,345,825 bp
  • A to T, chromosome 1 at 25,093,922 bp
  • G to A, chromosome 1 at 92,620,356 bp
  • A to G, chromosome 1 at 170,390,759 bp
  • G to T, chromosome 1 at 178,337,502 bp
  • A to C, chromosome 2 at 29,679,198 bp
  • T to C, chromosome 2 at 87,213,804 bp
  • A to T, chromosome 2 at 156,024,635 bp
  • A to G, chromosome 2 at 176,721,505 bp
  • T to C, chromosome 2 at 180,085,575 bp
  • A to T, chromosome 3 at 26,840,662 bp
  • GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA to GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA, chromosome 3 at 93,396,693 bp
  • T to C, chromosome 3 at 127,032,129 bp
  • A to G, chromosome 4 at 8,855,038 bp
  • A to G, chromosome 4 at 33,082,566 bp
  • A to G, chromosome 4 at 45,044,793 bp
  • A to T, chromosome 4 at 130,060,469 bp
  • A to G, chromosome 4 at 139,574,954 bp
  • A to T, chromosome 4 at 152,022,110 bp
  • T to A, chromosome 5 at 16,314,937 bp
  • A to G, chromosome 5 at 25,374,564 bp
  • T to C, chromosome 5 at 26,084,692 bp
  • T to A, chromosome 5 at 31,243,849 bp
  • C to A, chromosome 5 at 64,112,160 bp
  • T to A, chromosome 6 at 43,283,951 bp
  • T to C, chromosome 6 at 83,929,731 bp
  • T to A, chromosome 6 at 90,179,257 bp
  • G to A, chromosome 7 at 4,918,959 bp
  • C to T, chromosome 8 at 3,258,660 bp
  • C to A, chromosome 8 at 27,028,942 bp
  • C to A, chromosome 9 at 38,403,507 bp
  • T to C, chromosome 9 at 72,015,651 bp
  • C to T, chromosome 9 at 78,480,390 bp
  • T to A, chromosome 9 at 80,217,709 bp
  • T to C, chromosome 9 at 101,938,769 bp
  • T to C, chromosome 9 at 102,194,813 bp
  • G to A, chromosome 9 at 106,157,693 bp
  • T to C, chromosome 9 at 108,139,530 bp
  • C to A, chromosome 9 at 114,706,183 bp
  • A to T, chromosome 10 at 99,758,320 bp
  • A to T, chromosome 10 at 129,704,884 bp
  • G to A, chromosome 11 at 58,859,312 bp
  • G to A, chromosome 11 at 59,502,944 bp
  • T to C, chromosome 11 at 69,350,885 bp
  • A to T, chromosome 11 at 74,269,718 bp
  • T to A, chromosome 11 at 111,024,515 bp
  • G to A, chromosome 12 at 11,119,763 bp
  • A to T, chromosome 12 at 11,241,464 bp
  • A to C, chromosome 13 at 12,221,486 bp
  • G to T, chromosome 13 at 21,363,727 bp
  • C to T, chromosome 14 at 76,417,020 bp
  • T to A, chromosome 15 at 28,350,704 bp
  • A to T, chromosome 15 at 66,604,073 bp
  • C to T, chromosome 15 at 81,710,495 bp
  • T to C, chromosome 15 at 101,930,702 bp
  • A to G, chromosome 16 at 7,277,028 bp
  • A to G, chromosome 16 at 16,213,449 bp
  • G to A, chromosome 16 at 91,818,558 bp
  • T to A, chromosome 17 at 34,051,290 bp
  • A to T, chromosome 18 at 12,195,072 bp
  • A to T, chromosome 18 at 37,821,562 bp
  • A to T, chromosome 18 at 64,556,987 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8161 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067587-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.