Strain Name:
C57BL/6J-MtgxR8161Btlr/Mmmh
Stock Number:
067587-MU
Citation ID:
RRID:MMRRC_067587-MU
Other Names:
R8161 (G1)
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: Gena 52, Obt, Flo, GENA 47, WBE1, GENA 60, Edy, A730019I05Rik, Todo, Cycn, Mt, Cyn, Lda, Whi, Dz
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: Mll3, E330008K23Rik, HALR
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Ank2
Name: ankyrin 2, brain
Synonyms: Ankyrin-2, Ankyrin-B, ankyrin B, Gm4392, Ank-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Mtg2
Name: mitochondrial ribosome associated GTPase 2
Synonyms: Gtpbp5, D2Bwg0647e, 2900056P18Rik, 1810011P19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 52856
Homologene: 9233
Iffo2
Name: intermediate filament family orphan 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212632
Homologene: 102202
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Sh3p17, Ese1, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L, EHSH1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: E130113K22Rik, CGI-72
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Rangap1
Name: RAN GTPase activating protein 1
Synonyms: Fug1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19387
VEGA: 15
HGNC: HGNC:9854
Homologene: 55700
Tcf12
Name: transcription factor 12
Synonyms: ME1, REB, bHLHb20, HTF4, HEBAlt, ALF1, HEB, HTF-4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21406
Homologene: 40774
Tsc22d1
Name: TSC22 domain family, member 1
Synonyms: Egr5, Tgfb1i4, TSC-22
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21807
Homologene: 7573
Rapgef1
Name: Rap guanine nucleotide exchange factor (GEF) 1
Synonyms: C3G, Grf2, 4932418O06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107746
HGNC: HGNC:4568
Homologene: 50501
Eef1a1
Name: eukaryotic translation elongation factor 1 alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13627
HGNC: HGNC:3189
Homologene: 100799
Npc1
Name: NPC intracellular cholesterol transporter 1
Synonyms: lcsd, nmf164, C85354, A430089E03Rik, D18Ertd723e, D18Ertd139e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18145
HGNC: HGNC:7897
Homologene: 228
Mtr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase
Synonyms: methionine synthase, MS, D830038K18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238505
VEGA: 13
HGNC: HGNC:7468
Homologene: 37280
Stau2
Name: staufen double-stranded RNA binding protein 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 29819
Homologene: 8666
Hnrnpu
Name: heterogeneous nuclear ribonucleoprotein U
Synonyms: scaffold attachment factor A, Hnrpu, Sp120
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 51810
HGNC: HGNC:5048
Homologene: 22991
Dync1li1
Name: dynein cytoplasmic 1 light intermediate chain 1
Synonyms: Dlic1, LIC-1, Dnclic1, 1110053F02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235661
VEGA: 9
Homologene: 9403
Zbtb48
Name: zinc finger and BTB domain containing 48
Synonyms: Hkr3, 0610011D15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100090
HGNC: HGNC:4930
Homologene: 3905
Nrbp1
Name: nuclear receptor binding protein 1
Synonyms: Nrbp, B230344L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 192292
HGNC: HGNC:7993
Homologene: 8373
Pkp2
Name: plakophilin 2
Synonyms: Pkp2l, 1200008D14Rik, 1200012P04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67451
HGNC: HGNC:9024
Homologene: 3364
Atp8b1
Name: ATPase, class I, type 8B, member 1
Synonyms: FIC1, Ic
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 54670
VEGA: 18
HGNC: HGNC:3706
Homologene: 21151
Zkscan17
Name: zinc finger with KRAB and SCAN domains 17
Synonyms: Nizp1, Zfp496
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268417
Homologene: 13108
Myo6
Name: myosin VI
Synonyms: Tlc, Myo6rsv, rsv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17920
HGNC: HGNC:7605
Homologene: 56417
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b3491Clo, Mdnah5, b2b1537Clo, b2b1134Clo, Dnahc5, b2b1154Clo, b2b1565Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: Bai3, A830096D10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Chd7, 2600010P09Rik, Mi-2 alpha, Prp7, Prp9-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Gen1
Name: GEN1, Holliday junction 5' flap endonuclease
Synonyms: 5830483C08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209334
VEGA: 12
Homologene: 35313
Or1p1c
Name: olfactory receptor family 1 subfamily P member 1C
Synonyms: Olfr406-ps, MOR133-1, Olfr406, GA_x6K02T2P1NL-4415162-4416133
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258181
HGNC: HGNC:8222
Fer1l4
Name: fer-1 like family member 4
Synonyms: 9130402C12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74562
Homologene: 19075
Arhgef5
Name: Rho guanine nucleotide exchange factor 5
Synonyms: 2210412D05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54324
Homologene: 66300
Insr
Name: insulin receptor
Synonyms: D630014A15Rik, CD220, IR-B, IR, 4932439J01Rik, IR-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16337
HGNC: HGNC:6091
Homologene: 20090
Kcnj16
Name: potassium inwardly-rectifying channel, subfamily J, member 16
Synonyms: 6430410F18Rik, Kir5.1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16517
HGNC: HGNC:6262
Homologene: 23112
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Spata16
Name: spermatogenesis associated 16
Synonyms: 4930503K02Rik, Nyd-sp12, 4921511F01Rik, spermatogenesis-related protein
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70862
Homologene: 49974
Nos1ap
Name: nitric oxide synthase 1 (neuronal) adaptor protein
Synonyms: 6330408P19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70729
Homologene: 135990
Ephb1
Name: Eph receptor B1
Synonyms: C130099E04Rik, Elk, Net, Hek6, Elkh, Cek6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270190
HGNC: HGNC:3392
Homologene: 20936
Glyctk
Name: glycerate kinase
Synonyms: 6230410P16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235582
Homologene: 14738
Zfp628
Name: zinc finger protein 628
Synonyms: Zec
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232816
Homologene: 72200
Or6c6c
Name: olfactory receptor family 6 subfamily C member 6C
Synonyms: Olfr804, GA_x6K02T2PULF-11383575-11384519, MOR110-7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258068
Homologene: 133581
Zscan12
Name: zinc finger and SCAN domain containing 12
Synonyms: Zfp96
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22758
Homologene: 86980
Col16a1
Name: collagen, type XVI, alpha 1
Synonyms: [a]1 (XVI) collagen, A530052M23Rik, 2700007F12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107581
HGNC: HGNC:2193
Homologene: 1397
Cacna2d1
Name: calcium channel, voltage-dependent, alpha2/delta subunit 1
Synonyms: Cchl2a, Ca(v)alpha2delta1, Cacna2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12293
HGNC: HGNC:1399
Homologene: 579
Erlin2
Name: ER lipid raft associated 2
Synonyms: Spfh2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244373
HGNC: HGNC:1356
Homologene: 5193
Vmn1r52
Name: vomeronasal 1 receptor 52
Synonyms: V1ra7, VN3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113849
Pgm2
Name: phosphoglucomutase 2
Synonyms: Pgm-1, Pgm1, 3230402E02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66681
HGNC: HGNC:8906
Homologene: 6693
Or10ag52
Name: olfactory receptor family 10 subfamily AG member 52
Synonyms: Olfr1113, MOR264-25, GA_x6K02T2Q125-48697747-48698727
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404327
Homologene: 27114
9630041A04Rik
Name: RIKEN cDNA 9630041A04 gene
Type: Gene
Species: Mouse
Chromosome: 9
Kcns3
Name: potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Synonyms: D12Ertd137e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238076
VEGA: 12
HGNC: HGNC:6302
Homologene: 20518
Krt79
Name: keratin 79
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223917
Homologene: 89169
Rbfox1
Name: RNA binding protein, fox-1 homolog (C. elegans) 1
Synonyms: A2bp, HRNBP1, FOX1, A2bp1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268859
VEGA: 16
Homologene: 69339
Rptn
Name: repetin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20129
Homologene: 84780
Fbxo10
Name: F-box protein 10
Synonyms: LOC269529, FBX10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269529
Homologene: 19544
Speer4a2
Name: spermatogenesis associated glutamate (E)-rich protein 4A2
Synonyms: Gm10471
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100039045
Homologene: 69402
Or8b3
Name: olfactory receptor family 8 subfamily B member 3
Synonyms: MOR164-1, M3, GA_x6K02T2PVTD-32098059-32099003, Olfr147
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258869
VEGA: 9
Homologene: 128279
Gabrr2
Name: gamma-aminobutyric acid type A receptor subunit rho 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14409
HGNC: HGNC:4091
Homologene: 20471
Or9s13
Name: olfactory receptor family 9 subfamily S member 13
Synonyms: GA_x6K02T2R7CC-81134096-81133095, MOR208-5, Olfr12
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 257890
Homologene: 114777
Gm12258
Name: predicted gene 12258
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108167848
Csl
Name: citrate synthase like
Synonyms: 1700007H16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71832
VEGA: 10
HGNC: HGNC:2422
Homologene: 7131
Pcdhgc5
Name: protocadherin gamma subfamily C, 5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93708
HGNC: HGNC:8718
Homologene: 110933
Gm14305
Name: predicted gene 14305
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100043387
Homologene: 134324
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 16,345,825 bp
  • A to T, chromosome 1 at 25,093,922 bp
  • G to A, chromosome 1 at 92,620,356 bp
  • A to G, chromosome 1 at 170,390,759 bp
  • G to T, chromosome 1 at 178,337,502 bp
  • A to C, chromosome 2 at 29,679,198 bp
  • T to C, chromosome 2 at 87,213,804 bp
  • A to T, chromosome 2 at 156,024,635 bp
  • A to G, chromosome 2 at 176,721,505 bp
  • T to C, chromosome 2 at 180,085,575 bp
  • A to T, chromosome 3 at 26,840,662 bp
  • GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA to GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA, chromosome 3 at 93,396,693 bp
  • T to C, chromosome 3 at 127,032,129 bp
  • A to G, chromosome 4 at 8,855,038 bp
  • A to G, chromosome 4 at 33,082,566 bp
  • A to G, chromosome 4 at 45,044,793 bp
  • A to T, chromosome 4 at 130,060,469 bp
  • A to G, chromosome 4 at 139,574,954 bp
  • A to T, chromosome 4 at 152,022,110 bp
  • T to A, chromosome 5 at 16,314,937 bp
  • A to G, chromosome 5 at 25,374,564 bp
  • T to C, chromosome 5 at 26,084,692 bp
  • T to A, chromosome 5 at 31,243,849 bp
  • C to A, chromosome 5 at 64,112,160 bp
  • T to A, chromosome 6 at 43,283,951 bp
  • T to C, chromosome 6 at 83,929,731 bp
  • T to A, chromosome 6 at 90,179,257 bp
  • G to A, chromosome 7 at 4,918,959 bp
  • C to T, chromosome 8 at 3,258,660 bp
  • C to A, chromosome 8 at 27,028,942 bp
  • C to A, chromosome 9 at 38,403,507 bp
  • T to C, chromosome 9 at 72,015,651 bp
  • C to T, chromosome 9 at 78,480,390 bp
  • T to A, chromosome 9 at 80,217,709 bp
  • T to C, chromosome 9 at 101,938,769 bp
  • T to C, chromosome 9 at 102,194,813 bp
  • G to A, chromosome 9 at 106,157,693 bp
  • T to C, chromosome 9 at 108,139,530 bp
  • C to A, chromosome 9 at 114,706,183 bp
  • A to T, chromosome 10 at 99,758,320 bp
  • A to T, chromosome 10 at 129,704,884 bp
  • G to A, chromosome 11 at 58,859,312 bp
  • G to A, chromosome 11 at 59,502,944 bp
  • T to C, chromosome 11 at 69,350,885 bp
  • A to T, chromosome 11 at 74,269,718 bp
  • T to A, chromosome 11 at 111,024,515 bp
  • G to A, chromosome 12 at 11,119,763 bp
  • A to T, chromosome 12 at 11,241,464 bp
  • A to C, chromosome 13 at 12,221,486 bp
  • G to T, chromosome 13 at 21,363,727 bp
  • C to T, chromosome 14 at 76,417,020 bp
  • T to A, chromosome 15 at 28,350,704 bp
  • A to T, chromosome 15 at 66,604,073 bp
  • C to T, chromosome 15 at 81,710,495 bp
  • T to C, chromosome 15 at 101,930,702 bp
  • A to G, chromosome 16 at 7,277,028 bp
  • A to G, chromosome 16 at 16,213,449 bp
  • G to A, chromosome 16 at 91,818,558 bp
  • T to A, chromosome 17 at 34,051,290 bp
  • A to T, chromosome 18 at 12,195,072 bp
  • A to T, chromosome 18 at 37,821,562 bp
  • A to T, chromosome 18 at 64,556,987 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8161 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067587-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.