Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8189Btlr/Mmmh
Stock Number:
067612-MU
Citation ID:
RRID:MMRRC_067612-MU
Other Names:
R8189 (G1)
Major Collection:

Strain Information

Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Ipo11
Name: importin 11
Synonyms: E330021B14Rik, 1700081H05Rik, 2510001A17Rik, Ranbp11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76582
Homologene: 7089
Chka
Name: choline kinase alpha
Synonyms: choline/ethanolamine kinase alpha, CK/EK-alpha, ChoK, EtnK-alpha, Chk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12660
HGNC: HGNC:1937
Homologene: 88575
Setdb1
Name: SET domain, bifurcated 1
Synonyms: ESET, KMT1E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84505
Homologene: 32157
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 71,285,726 bp
  • A to T, chromosome 1 at 107,276,309 bp
  • A to G, chromosome 1 at 149,857,586 bp
  • T to C, chromosome 2 at 111,527,773 bp
  • G to A, chromosome 2 at 181,277,967 bp
  • A to T, chromosome 3 at 80,722,182 bp
  • A to G, chromosome 3 at 95,346,711 bp
  • G to A, chromosome 4 at 143,350,733 bp
  • T to G, chromosome 4 at 143,571,960 bp
  • T to A, chromosome 5 at 87,001,443 bp
  • A to G, chromosome 5 at 109,286,847 bp
  • A to G, chromosome 6 at 34,167,635 bp
  • A to G, chromosome 6 at 38,158,171 bp
  • T to C, chromosome 6 at 43,236,079 bp
  • C to T, chromosome 6 at 88,222,958 bp
  • A to G, chromosome 7 at 25,473,918 bp
  • A to G, chromosome 7 at 30,569,331 bp
  • G to T, chromosome 7 at 48,552,754 bp
  • C to T, chromosome 7 at 104,769,348 bp
  • A to G, chromosome 7 at 107,902,732 bp
  • G to A, chromosome 7 at 130,172,899 bp
  • A to G, chromosome 7 at 143,081,838 bp
  • A to G, chromosome 8 at 12,963,164 bp
  • TTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGG to TTCTGGCTCTGGCTCTGGCTCTGG, chromosome 8 at 95,303,620 bp
  • A to T, chromosome 9 at 55,912,120 bp
  • A to G, chromosome 9 at 83,847,219 bp
  • T to C, chromosome 10 at 94,074,215 bp
  • T to A, chromosome 10 at 129,541,253 bp
  • T to C, chromosome 11 at 57,217,799 bp
  • T to A, chromosome 11 at 86,215,570 bp
  • C to A, chromosome 12 at 44,570,508 bp
  • G to A, chromosome 12 at 100,838,630 bp
  • A to G, chromosome 13 at 61,037,155 bp
  • T to C, chromosome 13 at 91,855,775 bp
  • T to A, chromosome 13 at 106,925,096 bp
  • T to A, chromosome 13 at 112,891,981 bp
  • A to G, chromosome 15 at 89,549,236 bp
  • T to A, chromosome 16 at 58,760,925 bp
  • A to T, chromosome 17 at 18,258,356 bp
  • A to G, chromosome 17 at 35,145,238 bp
  • A to G, chromosome 17 at 35,526,666 bp
  • C to T, chromosome 17 at 90,704,209 bp
  • G to T, chromosome 19 at 3,875,759 bp
  • G to A, chromosome 19 at 4,270,852 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8189 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067612-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.