Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8189Btlr/Mmmh
Stock Number:
067612-MU
Citation ID:
RRID:MMRRC_067612-MU
Other Names:
R8189 (G1)
Major Collection:

Strain Information

Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Ipo11
Name: importin 11
Synonyms: E330021B14Rik, 1700081H05Rik, 2510001A17Rik, Ranbp11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76582
Homologene: 7089
Chka
Name: choline kinase alpha
Synonyms: choline/ethanolamine kinase alpha, CK/EK-alpha, ChoK, EtnK-alpha, Chk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12660
HGNC: HGNC:1937
Homologene: 88575
Setdb1
Name: SET domain, bifurcated 1
Synonyms: ESET, KMT1E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84505
Homologene: 32157
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Mtrex
Name: Mtr4 exosome RNA helicase
Synonyms: 2610528A15Rik, Skiv2l2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72198
VEGA: 13
Homologene: 6257
Ttk
Name: Ttk protein kinase
Synonyms: Esk1, Mps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22137
Homologene: 2489
Fgd6
Name: FYVE, RhoGEF and PH domain containing 6
Synonyms: ZFYVE24, Etohd4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13998
Homologene: 14209
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: Dbs, C130040G20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Fgfr2
Name: fibroblast growth factor receptor 2
Synonyms: Bek, KGFRTr, Fgfr-7, Fgfr-2, Fgfr7, svs, Fgfr2b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14183
HGNC: HGNC:3689
Homologene: 22566
Ints2
Name: integrator complex subunit 2
Synonyms: 2810417D08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70422
Homologene: 10801
Cngb1
Name: cyclic nucleotide gated channel beta 1
Synonyms: Cngb1, Cngb1b, BC016201
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 333329
HGNC: HGNC:2151
Homologene: 136420
Slc35b4
Name: solute carrier family 35, member B4
Synonyms: 4930474D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58246
Homologene: 5799
Trpm5
Name: transient receptor potential cation channel, subfamily M, member 5
Synonyms: Mtr1, Ltrpc5, 9430099A16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56843
Homologene: 22818
Ctsq
Name: cathepsin Q
Synonyms: 1600010J02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 104002
Homologene: 122226
Vmn2r15
Name: vomeronasal 2, receptor 15
Synonyms: EG211223
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211223
Homologene: 129606
Kmt2b
Name: lysine (K)-specific methyltransferase 2B
Synonyms: 2610014H22Rik, Mll2, Wbp7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75410
Homologene: 22838
Or5p52
Name: olfactory receptor family 5 subfamily P member 52
Synonyms: GA_x6K02T2PBJ9-10231953-10232885, MOR204-5, Olfr472
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258770
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: GluR1, GluR-A, Glr-1, Glur-1, Glur1, GluRA, Glr1, 2900051M01Rik, HIPA1, GluA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Pla2g4a
Name: phospholipase A2, group IVA (cytosolic, calcium-dependent)
Synonyms: cPLA2, Type IV PLA2, cytosolic PLA2, cPLA2alpha, cytosolic phospholipase A2, Pla2g4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18783
HGNC: HGNC:9035
Homologene: 32059
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Nrxn1
Name: neurexin I
Synonyms: alpha-latrotoxin receptor (calcium-dependent), neurexin I beta, neurexin I alpha, neurexin I beta, neurexin I beta, neurexin I alpha, neurexin I alpha, 1700062G21Rik, A230068P09Rik, 9330127H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Mrgprb2
Name: MAS-related GPR, member B2
Synonyms: 4833406I20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243979
Homologene: 86246
Bag6
Name: BCL2-associated athanogene 6
Synonyms: D17H6S52E, G3, 2410045D21Rik, Scythe, Bat3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224727
Homologene: 3409
Serpinb3c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms: 1110001H02Rik, 1110013A16Rik, ovalbumin, Serpinb4, Scca2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381286
Homologene: 131278
Lrrc38
Name: leucine rich repeat containing 38
Synonyms: A230053A07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242735
Homologene: 77949
Shank3
Name: SH3 and multiple ankyrin repeat domains 3
Synonyms: ProSAP2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 58234
Homologene: 75163
Ckmt2
Name: creatine kinase, mitochondrial 2
Synonyms: 2300008A19Rik, ScCKmit
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76722
HGNC: HGNC:1996
Homologene: 68206
Or6c66b
Name: olfactory receptor family 6 subfamily C member 66B
Synonyms: GA_x6K02T2PULF-11219415-11220350, MOR108-2, Olfr792
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258150
Homologene: 133881
Gmeb2
Name: glucocorticoid modulatory element binding protein 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229004
HGNC: HGNC:4371
Homologene: 8228
Ceacam1
Name: CEA cell adhesion molecule 1
Synonyms: CD66a, MHVR1, mmCGM1, mCEA1, mmCGM2, Hv-2, Bgp, Mhv-1, Cea-7, Cea-1, Cea1, Bgp1, C-CAM, Hv2, Cea7, Cc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26365
HGNC: HGNC:1814
Homologene: 128630
Dnajb8
Name: DnaJ heat shock protein family (Hsp40) member B8
Synonyms: mDj6, 1700016F14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56691
Homologene: 23184
Cchcr1
Name: coiled-coil alpha-helical rod protein 1
Synonyms: Hcr
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240084
Homologene: 10396
Ankrd13d
Name: ankyrin repeat domain 13 family, member D
Synonyms: 0710001P18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68423
Homologene: 27612
Or5k1b
Name: olfactory receptor family 5 subfamily K member 1B
Synonyms: GA_x54KRFPKG5P-54930346-54929417, MOR184-2, Olfr172
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259003
Homologene: 45084
Or2a57
Name: olfactory receptor family 2 subfamily A member 57
Synonyms: IB12, MOR261-9, GA_x6K02T2P3E9-4322325-4321360, Olfr47
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18346
Homologene: 133700
Or4f17
Name: olfactory receptor family 4 subfamily F member 17
Synonyms: GA_x6K02T2Q125-72578807-72579745, MOR245-24P, OTTMUSG00000015076, Or4f17-ps1, Olfr1293-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 623583
9030617O03Rik
Name:
Type: Gene
Species: Mouse
Chromosome: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 71,285,726 bp
  • A to T, chromosome 1 at 107,276,309 bp
  • A to G, chromosome 1 at 149,857,586 bp
  • T to C, chromosome 2 at 111,527,773 bp
  • G to A, chromosome 2 at 181,277,967 bp
  • A to T, chromosome 3 at 80,722,182 bp
  • A to G, chromosome 3 at 95,346,711 bp
  • G to A, chromosome 4 at 143,350,733 bp
  • T to G, chromosome 4 at 143,571,960 bp
  • T to A, chromosome 5 at 87,001,443 bp
  • A to G, chromosome 5 at 109,286,847 bp
  • A to G, chromosome 6 at 34,167,635 bp
  • A to G, chromosome 6 at 38,158,171 bp
  • T to C, chromosome 6 at 43,236,079 bp
  • C to T, chromosome 6 at 88,222,958 bp
  • A to G, chromosome 7 at 25,473,918 bp
  • A to G, chromosome 7 at 30,569,331 bp
  • G to T, chromosome 7 at 48,552,754 bp
  • C to T, chromosome 7 at 104,769,348 bp
  • A to G, chromosome 7 at 107,902,732 bp
  • G to A, chromosome 7 at 130,172,899 bp
  • A to G, chromosome 7 at 143,081,838 bp
  • A to G, chromosome 8 at 12,963,164 bp
  • TTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGG to TTCTGGCTCTGGCTCTGGCTCTGG, chromosome 8 at 95,303,620 bp
  • A to T, chromosome 9 at 55,912,120 bp
  • A to G, chromosome 9 at 83,847,219 bp
  • T to C, chromosome 10 at 94,074,215 bp
  • T to A, chromosome 10 at 129,541,253 bp
  • T to C, chromosome 11 at 57,217,799 bp
  • T to A, chromosome 11 at 86,215,570 bp
  • C to A, chromosome 12 at 44,570,508 bp
  • G to A, chromosome 12 at 100,838,630 bp
  • A to G, chromosome 13 at 61,037,155 bp
  • T to C, chromosome 13 at 91,855,775 bp
  • T to A, chromosome 13 at 106,925,096 bp
  • T to A, chromosome 13 at 112,891,981 bp
  • A to G, chromosome 15 at 89,549,236 bp
  • T to A, chromosome 16 at 58,760,925 bp
  • A to T, chromosome 17 at 18,258,356 bp
  • A to G, chromosome 17 at 35,145,238 bp
  • A to G, chromosome 17 at 35,526,666 bp
  • C to T, chromosome 17 at 90,704,209 bp
  • G to T, chromosome 19 at 3,875,759 bp
  • G to A, chromosome 19 at 4,270,852 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8189 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067612-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.