Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8266Btlr/Mmmh
Stock Number:
067691-MU
Citation ID:
RRID:MMRRC_067691-MU
Other Names:
R8266 (G1)
Major Collection:

Strain Information

Zfp113
Name: zinc finger protein 113
Synonyms: 4732456B05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56314
Homologene: 50027
Rps6ka1
Name: ribosomal protein S6 kinase A1
Synonyms: Rsk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20111
Homologene: 55703
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, 6330591G05Rik, Trap240L, 9030618F05Rik, Thrap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Zfp609
Name: zinc finger protein 609
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214812
Homologene: 72220
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Map4k4
Name: mitogen-activated protein kinase kinase kinase kinase 4
Synonyms: Nik, 9430080K19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26921
HGNC: HGNC:6866
Homologene: 7442
Kat6b
Name: K(lysine) acetyltransferase 6B
Synonyms: qkf, querkopf, Morf, B130044K16Rik, monocytic leukemia, Myst4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54169
Homologene: 136480
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 40,011,653 bp
  • T to C, chromosome 1 at 93,501,526 bp
  • G to T, chromosome 1 at 164,185,124 bp
  • A to G, chromosome 2 at 5,876,839 bp
  • T to A, chromosome 2 at 30,801,242 bp
  • A to T, chromosome 2 at 67,508,574 bp
  • T to C, chromosome 2 at 134,639,541 bp
  • T to C, chromosome 3 at 90,777,851 bp
  • T to C, chromosome 3 at 108,377,360 bp
  • C to T, chromosome 3 at 146,240,630 bp
  • G to A, chromosome 4 at 123,315,833 bp
  • G to A, chromosome 4 at 126,238,560 bp
  • T to A, chromosome 4 at 126,376,928 bp
  • G to A, chromosome 4 at 130,065,431 bp
  • A to G, chromosome 4 at 133,863,684 bp
  • G to T, chromosome 4 at 136,938,586 bp
  • A to T, chromosome 4 at 144,109,112 bp
  • T to A, chromosome 5 at 22,018,087 bp
  • CAT to CATAAT, chromosome 5 at 24,576,591 bp
  • T to G, chromosome 5 at 77,211,366 bp
  • T to C, chromosome 5 at 110,294,920 bp
  • T to A, chromosome 5 at 118,237,558 bp
  • T to G, chromosome 5 at 118,742,109 bp
  • C to T, chromosome 5 at 138,150,619 bp
  • A to T, chromosome 5 at 145,992,986 bp
  • T to A, chromosome 6 at 78,427,359 bp
  • T to C, chromosome 6 at 120,492,232 bp
  • A to G, chromosome 6 at 124,191,978 bp
  • C to T, chromosome 6 at 132,627,417 bp
  • G to A, chromosome 7 at 41,481,168 bp
  • T to C, chromosome 7 at 103,937,539 bp
  • C to T, chromosome 7 at 119,489,381 bp
  • T to C, chromosome 7 at 141,091,749 bp
  • T to C, chromosome 7 at 144,514,494 bp
  • C to T, chromosome 8 at 47,192,025 bp
  • A to G, chromosome 8 at 84,559,219 bp
  • A to G, chromosome 9 at 55,544,124 bp
  • G to T, chromosome 9 at 65,703,714 bp
  • G to A, chromosome 9 at 73,005,719 bp
  • A to T, chromosome 9 at 74,143,492 bp
  • T to A, chromosome 10 at 13,512,889 bp
  • A to T, chromosome 10 at 76,476,580 bp
  • A to G, chromosome 10 at 100,559,671 bp
  • T to A, chromosome 11 at 23,486,810 bp
  • T to A, chromosome 11 at 49,160,525 bp
  • T to C, chromosome 11 at 69,784,621 bp
  • T to A, chromosome 11 at 102,262,220 bp
  • T to C, chromosome 12 at 64,920,945 bp
  • T to A, chromosome 12 at 73,108,649 bp
  • AGCCTCCTTACTCG to AGCCTCCTTACTCGCCTCCTTACTCG, chromosome 13 at 31,626,378 bp
  • G to A, chromosome 14 at 8,482,599 bp
  • C to T, chromosome 14 at 21,516,845 bp
  • T to A, chromosome 15 at 5,007,659 bp
  • A to G, chromosome 16 at 87,947,979 bp
  • A to T, chromosome 18 at 3,309,535 bp
  • T to C, chromosome 18 at 49,843,811 bp
  • T to A, chromosome 18 at 61,258,213 bp
  • T to C, chromosome 18 at 74,204,341 bp
  • A to G, chromosome 19 at 37,577,049 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8266 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067691-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.