Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8282Btlr/Mmmh
Stock Number:
067705-MU
Citation ID:
RRID:MMRRC_067705-MU
Other Names:
R8282 (G1)
Major Collection:

Strain Information

Gstt2
Name: glutathione S-transferase, theta 2
Synonyms: mGSTT2, Yrs
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14872
VEGA: 10
Homologene: 37358
Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271639
Homologene: 10188
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Rfc1
Name: replication factor C (activator 1) 1
Synonyms: RFC140, Alp145, 140kDa, Recc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19687
HGNC: HGNC:9969
Homologene: 2187
Kdsr
Name: 3-ketodihydrosphingosine reductase
Synonyms: 6330410P18Rik, 9430079B08Rik, Fvt1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70750
HGNC: HGNC:4021
Homologene: 1539
Dctn1
Name: dynactin 1
Synonyms: Glued, p150, p150glued
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13191
HGNC: HGNC:2711
Homologene: 3011
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Ints9
Name: integrator complex subunit 9
Synonyms: D14Ertd231e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210925
VEGA: 14
Homologene: 10096
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: 1300012C07Rik, Nedd4-2, Nedd4b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Dkk3
Name: dickkopf WNT signaling pathway inhibitor 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50781
HGNC: HGNC:2893
Homologene: 8303
Niban2
Name: niban apoptosis regulator 2
Synonyms: 9130404D14Rik, Fam129b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227737
Homologene: 11269
Fam83h
Name: family with sequence similarity 83, member H
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105732
VEGA: 15
Homologene: 15890
Slc6a3
Name: solute carrier family 6 (neurotransmitter transporter, dopamine), member 3
Synonyms: DAT, Dat1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13162
VEGA: 13
Homologene: 55547
Jak1
Name: Janus kinase 1
Synonyms: C130039L05Rik, BAP004
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16451
HGNC: HGNC:6190
Homologene: 1678
Brf2
Name: BRF2, RNA polymerase III transcription initiation factor 50kDa subunit
Synonyms: 2700059M06Rik, BRFU, TFIIIB50, 5730512K07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66653
Homologene: 10127
Chst15
Name: carbohydrate sulfotransferase 15
Synonyms: GalNAcS-6ST, 4631426J05Rik, MAd5, MAd5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77590
Homologene: 8908
Fabp4
Name: fatty acid binding protein 4, adipocyte
Synonyms: ALBP/Ap2, Ap2, Lbpl, 422/aP2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11770
HGNC: HGNC:3559
Homologene: 36067
Khsrp
Name: KH-type splicing regulatory protein
Synonyms: 6330409F21Rik, KSRP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16549
VEGA: 17
HGNC: HGNC:6316
Homologene: 2734
Fmnl2
Name: formin-like 2
Synonyms: 5430425K04Rik, man
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71409
Homologene: 70871
Samd12
Name: sterile alpha motif domain containing 12
Synonyms: A830094I09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320679
Homologene: 35979
Taf6l
Name: TATA-box binding protein associated factor 6 like
Synonyms: PAF65A, C530024J06Rik, 2810417N14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225895
Homologene: 4728
Zfp268
Name: zinc finger protein 268
Synonyms: Gm13212
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433801
Homologene: 133076
Zfp648
Name: zinc finger protein 648
Synonyms: LOC207678, Gm10178
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100503355
Homologene: 18996
Trappc11
Name: trafficking protein particle complex 11
Synonyms: D030016E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320714
Homologene: 11076
Nwd1
Name: NACHT and WD repeat domain containing 1
Synonyms: A230063L24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319555
Homologene: 72261
Duxf4
Name: double homeobox family member 4
Synonyms: Duxf4, Gm4981
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 245263
Homologene: 134545
Or8b54
Name: olfactory receptor family 8 subfamily B member 54
Synonyms: GA_x6K02T2PVTD-32478047-32478988, MOR165-8, Olfr921
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258778
VEGA: 9
Homologene: 128138
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
Synpo2l
Name: synaptopodin 2-like
Synonyms: 1110054M18Rik, Chap
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68760
Homologene: 23499
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Or5k3
Name: olfactory receptor family 5 subfamily K member 3
Synonyms: GA_x54KRFPKG5P-55369823-55370749, MOR184-5, Olfr195
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259000
Homologene: 128109
Ugt2b37
Name: UDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms: 0610033E06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 112417
Homologene: 137225
Vmn2r56
Name: vomeronasal 2, receptor 56
Synonyms: EG629079
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 629079
Homologene: 104040
Cyld
Name: CYLD lysine 63 deubiquitinase
Synonyms: CYLD1, 2010013M14Rik, C130039D01Rik, 2900009M21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74256
HGNC: HGNC:2584
Homologene: 9069
Tent5c
Name: terminal nucleotidyltransferase 5C
Synonyms: 4930431B09Rik, Fam46c
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74645
Homologene: 56783
Cwh43
Name: cell wall biogenesis 43 C-terminal homolog
Synonyms: C130090K23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231293
Homologene: 5474
Axl
Name: AXL receptor tyrosine kinase
Synonyms: Tyro7, Ark, Ufo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26362
HGNC: HGNC:905
Homologene: 7583
Ces1d
Name: carboxylesterase 1D
Synonyms: TGH, Ces3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104158
HGNC: HGNC:1863
Homologene: 35606
Fbxo8
Name: F-box protein 8
Synonyms: Fbx8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50753
Homologene: 8137
Larp1b
Name: La ribonucleoprotein 1B
Synonyms: 1700108L22Rik, 4933421B21Rik, Larp2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214048
Homologene: 103869
Slc25a54
Name: solute carrier family 25, member 54
Synonyms: SCaMC-1like, 4930443G12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74686
Homologene: 82464
Fam43a
Name: family with sequence similarity 43, member A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224093
Homologene: 17800
Ankrd55
Name: ankyrin repeat domain 55
Synonyms: C030011J08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77318
VEGA: 13
Homologene: 12674
Or10ag57
Name: olfactory receptor family 10 subfamily AG member 57
Synonyms: GA_x6K02T2Q125-48880078-48881058, MOR264-1, Olfr1122
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259033
Homologene: 73977
Padi1
Name: peptidyl arginine deiminase, type I
Synonyms: Pdi1, Pad type 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18599
Homologene: 7881
Fank1
Name: fibronectin type 3 and ankyrin repeat domains 1
Synonyms: 1700007B22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66930
Homologene: 12055
Zscan4d
Name: zinc finger and SCAN domain containing 4D
Synonyms: EG545913
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545913
Homologene: 85986
Pdilt
Name: protein disulfide isomerase-like, testis expressed
Synonyms: PDILT, 1700007B13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71830
Homologene: 18382
Allc
Name: allantoicase
Synonyms: 1700012B22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94041
Homologene: 6202
Gm10110
Name: predicted gene 10110
Type: Gene
Species: Mouse
Chromosome: 14
Rpia
Name: ribose 5-phosphate isomerase A
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19895
Homologene: 6943
Rell2
Name: RELT-like 2
Synonyms: 4631403P03Rik, ependolin
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225392
Homologene: 17819
6330408A02Rik
Name:
Type: Gene
Species: Mouse
Chromosome: 7
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 106,724,997 bp
  • T to A, chromosome 1 at 118,837,971 bp
  • T to A, chromosome 1 at 154,204,789 bp
  • T to A, chromosome 1 at 165,510,337 bp
  • T to C, chromosome 1 at 179,777,806 bp
  • A to G, chromosome 2 at 32,919,017 bp
  • G to A, chromosome 2 at 53,107,666 bp
  • A to T, chromosome 2 at 87,388,508 bp
  • A to G, chromosome 2 at 121,199,042 bp
  • T to A, chromosome 3 at 10,205,282 bp
  • G to A, chromosome 3 at 41,036,810 bp
  • A to G, chromosome 3 at 100,473,011 bp
  • T to C, chromosome 3 at 109,098,689 bp
  • G to A, chromosome 4 at 101,179,541 bp
  • T to C, chromosome 4 at 140,814,703 bp
  • A to T, chromosome 4 at 145,622,977 bp
  • A to G, chromosome 5 at 65,268,946 bp
  • A to T, chromosome 5 at 73,434,229 bp
  • G to A, chromosome 5 at 87,254,581 bp
  • C to G, chromosome 5 at 93,273,343 bp
  • T to C, chromosome 6 at 70,771,018 bp
  • G to A, chromosome 6 at 83,199,756 bp
  • T to A, chromosome 7 at 11,162,442 bp
  • A to T, chromosome 7 at 12,715,674 bp
  • T to C, chromosome 7 at 13,261,610 bp
  • C to T, chromosome 7 at 25,763,954 bp
  • CGGCGGCGG to CGGCGGCGGGGCGGCGG, chromosome 7 at 97,579,920 bp
  • T to A, chromosome 7 at 112,118,282 bp
  • A to G, chromosome 7 at 119,498,070 bp
  • T to A, chromosome 7 at 132,270,150 bp
  • T to A, chromosome 7 at 133,876,764 bp
  • G to T, chromosome 8 at 27,124,593 bp
  • T to C, chromosome 8 at 47,516,589 bp
  • G to A, chromosome 8 at 56,591,520 bp
  • T to A, chromosome 8 at 72,704,952 bp
  • C to A, chromosome 8 at 88,705,415 bp
  • A to T, chromosome 8 at 93,186,112 bp
  • G to A, chromosome 9 at 38,775,281 bp
  • A to G, chromosome 9 at 108,107,691 bp
  • T to G, chromosome 10 at 58,236,326 bp
  • C to G, chromosome 10 at 75,832,457 bp
  • T to A, chromosome 11 at 21,300,464 bp
  • T to C, chromosome 12 at 28,557,357 bp
  • T to A, chromosome 13 at 73,557,081 bp
  • T to A, chromosome 13 at 112,323,041 bp
  • A to G, chromosome 14 at 20,661,136 bp
  • T to A, chromosome 14 at 65,007,308 bp
  • C to T, chromosome 14 at 89,898,241 bp
  • T to C, chromosome 15 at 53,860,249 bp
  • A to G, chromosome 15 at 55,420,880 bp
  • ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT to ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT, chromosome 15 at 76,002,775 bp
  • T to C, chromosome 16 at 30,601,288 bp
  • T to A, chromosome 16 at 59,149,166 bp
  • T to C, chromosome 17 at 57,024,123 bp
  • A to T, chromosome 18 at 37,957,612 bp
  • A to G, chromosome 18 at 65,191,489 bp
  • A to G, chromosome 19 at 8,773,350 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • T to G, chromosome 19 at 43,890,566 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8282 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067705-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.