Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8368Btlr/Mmmh
Stock Number:
067738-MU
Citation ID:
RRID:MMRRC_067738-MU
Other Names:
R8368 (G1)
Major Collection:

Strain Information

Zfp143
Name: zinc finger protein 143
Synonyms: D7Ertd805e, pHZ-1, KRAB14, Zfp79, Zfp80-rs1, Staf
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20841
Homologene: 56444
Arhgap39
Name: Rho GTPase activating protein 39
Synonyms: D15Wsu169e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223666
Homologene: 27825
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Hsf2
Name: heat shock factor 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15500
VEGA: 10
HGNC: HGNC:5225
Homologene: 37931
Dip2b
Name: disco interacting protein 2 homolog B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239667
Homologene: 72227
Ccdc14
Name: coiled-coil domain containing 14
Synonyms: G630039H03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239839
VEGA: 16
Homologene: 32549
Kctd3
Name: potassium channel tetramerisation domain containing 3
Synonyms: NY-REN-45, E330032J19Rik, 4930438A20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226823
Homologene: 9395
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 59,094,661 bp
  • G to T, chromosome 1 at 75,129,637 bp
  • A to G, chromosome 1 at 135,831,526 bp
  • G to A, chromosome 1 at 188,972,207 bp
  • T to C, chromosome 2 at 132,750,513 bp
  • A to G, chromosome 2 at 151,653,470 bp
  • C to A, chromosome 3 at 15,990,738 bp
  • A to T, chromosome 3 at 30,765,425 bp
  • A to G, chromosome 3 at 70,027,866 bp
  • A to G, chromosome 3 at 94,072,586 bp
  • A to G, chromosome 3 at 100,923,356 bp
  • A to T, chromosome 3 at 104,095,063 bp
  • A to G, chromosome 4 at 106,746,993 bp
  • A to G, chromosome 4 at 109,013,698 bp
  • TGAGGAGGAGGAGGAGGAGGAG to TGAGGAGGAGGAGGAGGAG, chromosome 4 at 134,327,706 bp
  • A to T, chromosome 5 at 15,524,850 bp
  • A to C, chromosome 5 at 24,539,617 bp
  • G to T, chromosome 5 at 104,459,787 bp
  • A to G, chromosome 5 at 120,671,550 bp
  • G to A, chromosome 5 at 140,613,226 bp
  • A to G, chromosome 7 at 68,187,048 bp
  • T to C, chromosome 7 at 102,115,016 bp
  • A to T, chromosome 7 at 110,083,248 bp
  • T to C, chromosome 7 at 128,114,749 bp
  • T to G, chromosome 8 at 4,515,698 bp
  • C to T, chromosome 9 at 73,930,788 bp
  • T to A, chromosome 10 at 52,064,737 bp
  • T to A, chromosome 10 at 57,512,145 bp
  • A to G, chromosome 11 at 53,683,328 bp
  • T to A, chromosome 12 at 90,332,041 bp
  • C to A, chromosome 13 at 30,540,816 bp
  • T to C, chromosome 14 at 31,148,411 bp
  • T to C, chromosome 14 at 55,679,573 bp
  • G to A, chromosome 15 at 63,825,053 bp
  • A to T, chromosome 15 at 76,735,255 bp
  • T to C, chromosome 15 at 98,045,374 bp
  • T to C, chromosome 15 at 100,154,243 bp
  • T to C, chromosome 16 at 34,723,372 bp
  • T to C, chromosome 18 at 80,291,658 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8368 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067738-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.