Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8368Btlr/Mmmh
Stock Number:
067738-MU
Citation ID:
RRID:MMRRC_067738-MU
Other Names:
R8368 (G1)
Major Collection:

Strain Information

Zfp143
Name: zinc finger protein 143
Synonyms: D7Ertd805e, pHZ-1, KRAB14, Zfp79, Zfp80-rs1, Staf
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20841
Homologene: 56444
Arhgap39
Name: Rho GTPase activating protein 39
Synonyms: D15Wsu169e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223666
Homologene: 27825
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Hsf2
Name: heat shock factor 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15500
VEGA: 10
HGNC: HGNC:5225
Homologene: 37931
Dip2b
Name: disco interacting protein 2 homolog B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239667
Homologene: 72227
Ccdc14
Name: coiled-coil domain containing 14
Synonyms: G630039H03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239839
VEGA: 16
Homologene: 32549
Kctd3
Name: potassium channel tetramerisation domain containing 3
Synonyms: NY-REN-45, E330032J19Rik, 4930438A20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226823
Homologene: 9395
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: 2310046A20Rik, E330036L07Rik, D15Ertd528e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223870
Homologene: 8731
Lfng
Name: LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonyms: lunatic fringe
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16848
HGNC: HGNC:6560
Homologene: 22475
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Rad50l, Mrell
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Samd7
Name: sterile alpha motif domain containing 7
Synonyms: 4930597A01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75953
Homologene: 18802
Rasal1
Name: RAS protein activator like 1 (GAP1 like)
Synonyms: MRASAL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19415
HGNC: HGNC:9873
Homologene: 3423
Chrna10
Name: cholinergic receptor, nicotinic, alpha polypeptide 10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 504186
Homologene: 56886
Fam151a
Name: family with sequence simliarity 151, member A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230579
Homologene: 17143
Pkd2
Name: polycystin 2, transient receptor potential cation channel
Synonyms: polycystin-2, C030034P18Rik, TRPP2, PC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18764
HGNC: HGNC:9009
Homologene: 20104
Uqcrfs1
Name: ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Synonyms: 4430402G14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66694
Homologene: 4378
Shld1
Name: shieldin complex subunit 1
Synonyms: 1110034G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73747
Homologene: 51865
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 4732496O19Rik, 6530407C02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99470
Homologene: 26431
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Trim45
Name: tripartite motif-containing 45
Synonyms: 4921530N01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229644
Homologene: 11865
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192187
Homologene: 9035
Otol1
Name: otolin 1
Synonyms: LOC229389, Gm414
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229389
Homologene: 19018
Nrxn3
Name: neurexin III
Synonyms: neurexin III beta, neurexin III alpha, neurexin III beta, neurexin III alpha, 9330112C09Rik, D12Bwg0831e, 4933401A11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18191
HGNC: HGNC:8010
Homologene: 83225
Asb10
Name: ankyrin repeat and SOCS box-containing 10
Synonyms: Asb-10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117590
Homologene: 135975
Rad21l
Name: RAD21-like (S. pombe)
Synonyms: Gm14160
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668929
Homologene: 82650
Nrdc
Name: nardilysin convertase
Synonyms: NRD-C, Nrd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230598
HGNC: HGNC:7995
Homologene: 68260
Slc66a2
Name: solute carrier family 66 member 2
Synonyms: C78974, 5730564E11Rik, 4933425L21Rik, 2310009N05Rik, Pqlc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66943
Homologene: 32623
Slc23a3
Name: solute carrier family 23 (nucleobase transporters), member 3
Synonyms: SVCT3, Yspl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22626
Homologene: 65865
Trim63
Name: tripartite motif-containing 63
Synonyms: MuRF1, Rnf28
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433766
Homologene: 41878
Tinf2
Name: Terf1 (TRF1)-interacting nuclear factor 2
Synonyms: TIN2, D14Wsu146e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 28113
VEGA: 14
Homologene: 8264
Cers4
Name: ceramide synthase 4
Synonyms: 2900019C14Rik, Trh1, CerS4, Lass4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67260
Homologene: 11582
C2cd6
Name: C2 calcium dependent domain containing 6
Synonyms: 1700052H20Rik, 4930408G06Rik, Als2cr11, Als2cr11b, Gm33589, C2cd6b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73463
Homologene: 134310
Gm5150
Name: predicted gene 5150
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381484
Homologene: 129516
Gm21190
Name: predicted gene, 21190
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100861755
Homologene: 69402
Gm49368
Name: predicted gene, 49368
Type: Gene
Species: Mouse
Chromosome: 7
Tdpoz7
Name: Td and POZ domain containing 7
Synonyms: Gm10697
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100042761
Homologene: 128308
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 59,094,661 bp
  • G to T, chromosome 1 at 75,129,637 bp
  • A to G, chromosome 1 at 135,831,526 bp
  • G to A, chromosome 1 at 188,972,207 bp
  • T to C, chromosome 2 at 132,750,513 bp
  • A to G, chromosome 2 at 151,653,470 bp
  • C to A, chromosome 3 at 15,990,738 bp
  • A to T, chromosome 3 at 30,765,425 bp
  • A to G, chromosome 3 at 70,027,866 bp
  • A to G, chromosome 3 at 94,072,586 bp
  • A to G, chromosome 3 at 100,923,356 bp
  • A to T, chromosome 3 at 104,095,063 bp
  • A to G, chromosome 4 at 106,746,993 bp
  • A to G, chromosome 4 at 109,013,698 bp
  • TGAGGAGGAGGAGGAGGAGGAG to TGAGGAGGAGGAGGAGGAG, chromosome 4 at 134,327,706 bp
  • A to T, chromosome 5 at 15,524,850 bp
  • A to C, chromosome 5 at 24,539,617 bp
  • G to T, chromosome 5 at 104,459,787 bp
  • A to G, chromosome 5 at 120,671,550 bp
  • G to A, chromosome 5 at 140,613,226 bp
  • A to G, chromosome 7 at 68,187,048 bp
  • T to C, chromosome 7 at 102,115,016 bp
  • A to T, chromosome 7 at 110,083,248 bp
  • T to C, chromosome 7 at 128,114,749 bp
  • T to G, chromosome 8 at 4,515,698 bp
  • C to T, chromosome 9 at 73,930,788 bp
  • T to A, chromosome 10 at 52,064,737 bp
  • T to A, chromosome 10 at 57,512,145 bp
  • A to G, chromosome 11 at 53,683,328 bp
  • T to A, chromosome 12 at 90,332,041 bp
  • C to A, chromosome 13 at 30,540,816 bp
  • T to C, chromosome 14 at 31,148,411 bp
  • T to C, chromosome 14 at 55,679,573 bp
  • G to A, chromosome 15 at 63,825,053 bp
  • A to T, chromosome 15 at 76,735,255 bp
  • T to C, chromosome 15 at 98,045,374 bp
  • T to C, chromosome 15 at 100,154,243 bp
  • T to C, chromosome 16 at 34,723,372 bp
  • T to C, chromosome 18 at 80,291,658 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8368 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067738-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.