Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8377Btlr/Mmmh
Stock Number:
067745-MU
Citation ID:
RRID:MMRRC_067745-MU
Other Names:
R8377 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22359
Homologene: 443
Kcnmb4
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms: Slowpoke beta 4, 2900045G12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58802
HGNC: HGNC:6289
Homologene: 8721
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Top1
Name: topoisomerase (DNA) I
Synonyms: Top-1, D130064I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21969
Homologene: 2467
Nfya
Name: nuclear transcription factor-Y alpha
Synonyms: Sez10, Cbf-b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18044
HGNC: HGNC:7804
Homologene: 32114
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 55,323,678 bp
  • A to T, chromosome 1 at 118,198,863 bp
  • A to G, chromosome 1 at 170,668,784 bp
  • G to T, chromosome 1 at 171,437,543 bp
  • G to T, chromosome 1 at 174,608,445 bp
  • T to A, chromosome 2 at 49,522,515 bp
  • T to A, chromosome 2 at 111,269,638 bp
  • C to T, chromosome 2 at 160,646,089 bp
  • T to C, chromosome 2 at 160,754,922 bp
  • A to G, chromosome 3 at 108,781,939 bp
  • A to G, chromosome 3 at 138,326,123 bp
  • T to A, chromosome 4 at 59,914,713 bp
  • A to G, chromosome 4 at 118,444,057 bp
  • A to T, chromosome 4 at 118,782,006 bp
  • G to T, chromosome 4 at 123,342,689 bp
  • T to C, chromosome 4 at 128,615,773 bp
  • C to A, chromosome 4 at 131,808,335 bp
  • T to C, chromosome 4 at 141,068,223 bp
  • C to G, chromosome 5 at 96,226,367 bp
  • T to A, chromosome 5 at 105,118,462 bp
  • A to T, chromosome 5 at 117,376,701 bp
  • G to A, chromosome 5 at 128,780,331 bp
  • A to T, chromosome 5 at 137,391,687 bp
  • A to T, chromosome 6 at 72,328,674 bp
  • T to C, chromosome 6 at 102,209,293 bp
  • G to C, chromosome 6 at 108,510,738 bp
  • T to C, chromosome 7 at 45,102,563 bp
  • T to C, chromosome 7 at 45,830,612 bp
  • T to C, chromosome 7 at 85,615,499 bp
  • T to G, chromosome 7 at 107,933,685 bp
  • A to G, chromosome 7 at 110,800,730 bp
  • G to A, chromosome 7 at 122,181,292 bp
  • T to A, chromosome 7 at 129,606,688 bp
  • G to A, chromosome 8 at 11,004,848 bp
  • GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,042,160 bp
  • A to T, chromosome 8 at 25,182,283 bp
  • A to T, chromosome 8 at 70,135,310 bp
  • A to C, chromosome 8 at 105,842,547 bp
  • T to C, chromosome 8 at 109,635,350 bp
  • A to C, chromosome 9 at 15,262,359 bp
  • G to A, chromosome 9 at 37,631,605 bp
  • A to T, chromosome 9 at 54,378,748 bp
  • A to G, chromosome 9 at 54,622,505 bp
  • G to T, chromosome 9 at 58,149,205 bp
  • A to G, chromosome 10 at 19,011,510 bp
  • A to T, chromosome 10 at 41,581,310 bp
  • A to C, chromosome 10 at 57,800,936 bp
  • G to T, chromosome 10 at 68,097,387 bp
  • A to T, chromosome 10 at 116,446,385 bp
  • C to A, chromosome 11 at 34,401,964 bp
  • T to C, chromosome 11 at 97,551,978 bp
  • G to T, chromosome 12 at 30,884,851 bp
  • T to C, chromosome 12 at 76,438,441 bp
  • G to A, chromosome 12 at 78,664,506 bp
  • C to A, chromosome 12 at 84,058,787 bp
  • A to T, chromosome 13 at 100,425,866 bp
  • T to G, chromosome 13 at 104,161,001 bp
  • T to A, chromosome 14 at 31,000,146 bp
  • T to C, chromosome 15 at 25,804,395 bp
  • C to T, chromosome 15 at 34,345,365 bp
  • C to A, chromosome 16 at 55,246,654 bp
  • A to C, chromosome 16 at 57,307,394 bp
  • T to A, chromosome 17 at 20,913,977 bp
  • C to A, chromosome 17 at 33,067,064 bp
  • A to G, chromosome 17 at 48,392,045 bp
  • T to A, chromosome 17 at 87,985,170 bp
  • T to A, chromosome 18 at 20,333,774 bp
  • T to C, chromosome 19 at 3,292,487 bp
  • C to T, chromosome 19 at 6,998,981 bp
  • T to G, chromosome 19 at 12,935,035 bp
  • T to A, chromosome 19 at 27,234,858 bp
  • T to C, chromosome 19 at 32,124,421 bp
  • A to T, chromosome Y at 725,723 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8377 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067745-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.