Strain Name:
C57BL/6J-MtgxR8377Btlr/Mmmh
Stock Number:
067745-MU
Citation ID:
RRID:MMRRC_067745-MU
Other Names:
R8377 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22359
Homologene: 443
Kcnmb4
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms: Slowpoke beta 4, 2900045G12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58802
HGNC: HGNC:6289
Homologene: 8721
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Top1
Name: topoisomerase (DNA) I
Synonyms: Top-1, D130064I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21969
Homologene: 2467
Nfya
Name: nuclear transcription factor-Y alpha
Synonyms: Sez10, Cbf-b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18044
HGNC: HGNC:7804
Homologene: 32114
Fmn2
Name: formin 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54418
Homologene: 137334
Gphn
Name: gephyrin
Synonyms: geph, 5730552E08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268566
VEGA: 12
Homologene: 10820
Cmss1
Name: cms small ribosomal subunit 1
Synonyms: 4930572F24Rik, 1110001A06Rik, 2610528E23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66497
VEGA: 16
Homologene: 11979
Epc2
Name: enhancer of polycomb homolog 2
Synonyms: D2Ertd694e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227867
Homologene: 32274
Plcg1
Name: phospholipase C, gamma 1
Synonyms: Plc-1, Plcg-1, Plc-gamma1, Cded
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18803
HGNC: HGNC:9065
Homologene: 1997
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Pcp-1, Itpr-1, Ip3r, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Tacc1
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: 4833447E04Rik, Tacc1, B230378H13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320165
Homologene: 4575
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Msh6
Name: mutS homolog 6
Synonyms: Msh6, GTBP, Gtmbp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17688
VEGA: 17
HGNC: HGNC:7329
Homologene: 149
Zfy1
Name: zinc finger protein 1, Y-linked
Synonyms: Zfy-1
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22767
Homologene: 56456
Usp39
Name: ubiquitin specific peptidase 39
Synonyms: D6Wsu157e, CGI-21, SAD1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28035
Homologene: 13183
F11r
Name: F11 receptor
Synonyms: BV11 antigen, Ly106, JAM-1, ESTM33, Jcam1, JAM-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16456
Homologene: 14255
Grwd1
Name: glutamate-rich WD repeat containing 1
Synonyms: WDR28
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101612
Homologene: 6644
Stra6
Name: stimulated by retinoic acid gene 6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20897
Homologene: 7554
Olfml2b
Name: olfactomedin-like 2B
Synonyms: 1110018N05Rik, 4832415H08Rik, photomedin-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320078
Homologene: 18546
Ern2
Name: endoplasmic reticulum to nucleus signalling 2
Synonyms: Ire1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26918
Homologene: 22687
Med17
Name: mediator complex subunit 17
Synonyms: C330002H14Rik, Trap80, Crsp6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234959
VEGA: 9
HGNC: HGNC:2375
Homologene: 3151
Cntn3
Name: contactin 3
Synonyms: Pang
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18488
HGNC: HGNC:2173
Homologene: 7461
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Wdr11
Name: WD repeat domain 11
Synonyms: 2900055P10Rik, Wdr11, Brwd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207425
Homologene: 41229
Slc46a2
Name: solute carrier family 46, member 2
Synonyms: TSO-1C12, Ly110, 5430429N04Rik, Tscot
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30936
Homologene: 23273
Aknad1
Name: AKNA domain containing 1
Synonyms: 4921525H12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329738
Homologene: 51892
Ampd3
Name: adenosine monophosphate deaminase 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11717
HGNC: HGNC:470
Homologene: 408
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Tnfaip3
Name: tumor necrosis factor, alpha-induced protein 3
Synonyms: A20, zinc finger protein A20, Tnfip3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21929
Homologene: 4582
Naip1
Name: NLR family, apoptosis inhibitory protein 1
Synonyms: D13Lsd1, Naip, Birc1a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17940
VEGA: 13
HGNC: HGNC:7634
Homologene: 113589
Phf8l
Name: PHD finger protein 8 like
Synonyms: 4921501E09Rik, Phf8-ps
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74042
VEGA: 17
Homologene: 66275
Irs2
Name: insulin receptor substrate 2
Synonyms: Irs-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384783
HGNC: HGNC:6126
Homologene: 2778
Mrpl21
Name: mitochondrial ribosomal protein L21
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353242
Homologene: 32936
Ppp1r36
Name: protein phosphatase 1, regulatory subunit 36
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 210762
VEGA: 12
Homologene: 52094
Or4k35
Name: olfactory receptor family 4 subfamily K member 35
Synonyms: GA_x6K02T2Q125-72321818-72320907, MOR248-11, Olfr1277
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258391
Homologene: 105176
Wsb2
Name: WD repeat and SOCS box-containing 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59043
Homologene: 32417
Matn2
Name: matrilin 2
Synonyms: Crtm2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17181
VEGA: 15
HGNC: HGNC:6908
Homologene: 20538
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
Gbp4
Name: guanylate binding protein 4
Synonyms: Mag-2, Mpa-2, Mpa2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17472
Homologene: 128731
Rimbp2
Name: RIMS binding protein 2
Synonyms: A930033C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231760
Homologene: 14672
Mpl
Name: myeloproliferative leukemia virus oncogene
Synonyms: c-mpl, thrombopoietin receptor, TPO-R, CD110, c-mpl-II, c-mpl-I, hlb219
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17480
HGNC: HGNC:7217
Homologene: 7845
Tsnaxip1
Name: translin-associated factor X (Tsnax) interacting protein 1
Synonyms: TXI1, 1700016K08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72236
Homologene: 10194
Or5p53
Name: olfactory receptor family 5 subfamily P member 53
Synonyms: GA_x6K02T2PBJ9-10262759-10263691, MOR204-4, Olfr473
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258771
Homologene: 74116
Or5b24
Name: olfactory receptor family 5 subfamily B member 24
Synonyms: GA_x6K02T2RE5P-3264213-3265157, MOR202-34, Olfr1449
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258300
Homologene: 17184
Ptpru
Name: protein tyrosine phosphatase receptor type U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19273
HGNC: HGNC:9683
Homologene: 4168
Insyn2b
Name: inhibitory synaptic factor family member 2B
Synonyms: Gm6041, Fam196b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 574403
VEGA: 11
Homologene: 107175
Zpld1
Name: zona pellucida like domain containing 1
Synonyms: 9430016A21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239852
Homologene: 18401
Fcgrt
Name: Fc fragment of IgG receptor and transporter
Synonyms: FcRn, neonatal Fc receptor
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14132
HGNC: HGNC:3621
Homologene: 3030
BB014433
Name: expressed sequence BB014433
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434285
Acsbg1
Name: acyl-CoA synthetase bubblegum family member 1
Synonyms: E230019G03Rik, BG1, Lpd, Bgm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 94180
Homologene: 9044
Trpt1
Name: tRNA phosphotransferase 1
Synonyms: TPT1, EST-MNCb3719, Tpt1h
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107328
VEGA: 19
Homologene: 12878
Ccdc162
Name: coiled-coil domain containing 162
Synonyms: 5033413D22Rik, Gm29096, Gm6976
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75973
Homologene: 136355
Bmp8a
Name: bone morphogenetic protein 8a
Synonyms: osteogenic protein 2, OP2, Bmp7r1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12163
Homologene: 135983
Smpdl3a
Name: sphingomyelin phosphodiesterase, acid-like 3A
Synonyms: 0610010C24Rik, ASM3A, ASML3A
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57319
Homologene: 4886
Trappc13
Name: trafficking protein particle complex 13
Synonyms: 2610524F24Rik, 2410002O22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66975
Homologene: 11792
Siae
Name: sialic acid acetylesterase
Synonyms: LSE, clone 165, Ysg2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22619
Homologene: 8001
Vmn2r71
Name: vomeronasal 2, receptor 71
Synonyms: EG233445
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233445
Homologene: 115466
Acot3
Name: acyl-CoA thioesterase 3
Synonyms: PTE-Ia, Pte2a
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 171281
Homologene: 134585
Adh6a
Name: alcohol dehydrogenase 6A (class V)
Synonyms: 1810009C16Rik, Adh5a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69117
Homologene: 66291
Tlr12
Name: toll-like receptor 12
Synonyms: LOC384059, Tlr11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 384059
Homologene: 135964
Mrpl1
Name: mitochondrial ribosomal protein L1
Synonyms: 2410002L03Rik, 5830418D04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 94061
Homologene: 41355
Sgms1
Name: sphingomyelin synthase 1
Synonyms: SMS1, 9530058O11Rik, SMS1gamma, SMS1beta, SMS1alpha2, SMS1alpha1, Tmem23
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 208449
Homologene: 27040
Vmn1r232
Name: vomeronasal 1 receptor 232
Synonyms: V1re4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171227
Homologene: 121611
Or10ak13
Name: olfactory receptor family 10 subfamily AK member 13
Synonyms: GA_x6K02SYWGW3-414-3, GA_x6K02T2QD9B-18767132-18768073, MOR259-10, Olfr219-ps1, Olfr1337
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258306
Homologene: 121524
Rfxank
Name: regulatory factor X-associated ankyrin-containing protein
Synonyms: Tvl1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19727
HGNC: HGNC:9987
Homologene: 2760
Srcin1
Name: SRC kinase signaling inhibitor 1
Synonyms: P140, p140Cap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56013
Homologene: 10324
Boll
Name: boule homolog, RNA binding protein
Synonyms: 4930597B14Rik, 4930554P13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75388
Homologene: 33650
Alkal2
Name: ALK and LTK ligand 2
Synonyms: 6230419C23Rik, Fam150b, Augalpha, Augmentor alpha
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100294583
VEGA: 12
Homologene: 87330
Necap2
Name: NECAP endocytosis associated 2
Synonyms: 1110005F07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66147
Homologene: 9168
Spcs1
Name: signal peptidase complex subunit 1 homolog (S. cerevisiae)
Synonyms: 1810004F21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69019
Homologene: 40915
Gm29106
Name: predicted gene 29106
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 55,323,678 bp
  • A to T, chromosome 1 at 118,198,863 bp
  • A to G, chromosome 1 at 170,668,784 bp
  • G to T, chromosome 1 at 171,437,543 bp
  • G to T, chromosome 1 at 174,608,445 bp
  • T to A, chromosome 2 at 49,522,515 bp
  • T to A, chromosome 2 at 111,269,638 bp
  • C to T, chromosome 2 at 160,646,089 bp
  • T to C, chromosome 2 at 160,754,922 bp
  • A to G, chromosome 3 at 108,781,939 bp
  • A to G, chromosome 3 at 138,326,123 bp
  • T to A, chromosome 4 at 59,914,713 bp
  • A to G, chromosome 4 at 118,444,057 bp
  • A to T, chromosome 4 at 118,782,006 bp
  • G to T, chromosome 4 at 123,342,689 bp
  • T to C, chromosome 4 at 128,615,773 bp
  • C to A, chromosome 4 at 131,808,335 bp
  • T to C, chromosome 4 at 141,068,223 bp
  • C to G, chromosome 5 at 96,226,367 bp
  • T to A, chromosome 5 at 105,118,462 bp
  • A to T, chromosome 5 at 117,376,701 bp
  • G to A, chromosome 5 at 128,780,331 bp
  • A to T, chromosome 5 at 137,391,687 bp
  • A to T, chromosome 6 at 72,328,674 bp
  • T to C, chromosome 6 at 102,209,293 bp
  • G to C, chromosome 6 at 108,510,738 bp
  • T to C, chromosome 7 at 45,102,563 bp
  • T to C, chromosome 7 at 45,830,612 bp
  • T to C, chromosome 7 at 85,615,499 bp
  • T to G, chromosome 7 at 107,933,685 bp
  • A to G, chromosome 7 at 110,800,730 bp
  • G to A, chromosome 7 at 122,181,292 bp
  • T to A, chromosome 7 at 129,606,688 bp
  • G to A, chromosome 8 at 11,004,848 bp
  • GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,042,160 bp
  • A to T, chromosome 8 at 25,182,283 bp
  • A to T, chromosome 8 at 70,135,310 bp
  • A to C, chromosome 8 at 105,842,547 bp
  • T to C, chromosome 8 at 109,635,350 bp
  • A to C, chromosome 9 at 15,262,359 bp
  • G to A, chromosome 9 at 37,631,605 bp
  • A to T, chromosome 9 at 54,378,748 bp
  • A to G, chromosome 9 at 54,622,505 bp
  • G to T, chromosome 9 at 58,149,205 bp
  • A to G, chromosome 10 at 19,011,510 bp
  • A to T, chromosome 10 at 41,581,310 bp
  • A to C, chromosome 10 at 57,800,936 bp
  • G to T, chromosome 10 at 68,097,387 bp
  • A to T, chromosome 10 at 116,446,385 bp
  • C to A, chromosome 11 at 34,401,964 bp
  • T to C, chromosome 11 at 97,551,978 bp
  • G to T, chromosome 12 at 30,884,851 bp
  • T to C, chromosome 12 at 76,438,441 bp
  • G to A, chromosome 12 at 78,664,506 bp
  • C to A, chromosome 12 at 84,058,787 bp
  • A to T, chromosome 13 at 100,425,866 bp
  • T to G, chromosome 13 at 104,161,001 bp
  • T to A, chromosome 14 at 31,000,146 bp
  • T to C, chromosome 15 at 25,804,395 bp
  • C to T, chromosome 15 at 34,345,365 bp
  • C to A, chromosome 16 at 55,246,654 bp
  • A to C, chromosome 16 at 57,307,394 bp
  • T to A, chromosome 17 at 20,913,977 bp
  • C to A, chromosome 17 at 33,067,064 bp
  • A to G, chromosome 17 at 48,392,045 bp
  • T to A, chromosome 17 at 87,985,170 bp
  • T to A, chromosome 18 at 20,333,774 bp
  • T to C, chromosome 19 at 3,292,487 bp
  • C to T, chromosome 19 at 6,998,981 bp
  • T to G, chromosome 19 at 12,935,035 bp
  • T to A, chromosome 19 at 27,234,858 bp
  • T to C, chromosome 19 at 32,124,421 bp
  • A to T, chromosome Y at 725,723 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8377 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067745-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.