Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8390Btlr/Mmmh
Stock Number:
067755-MU
Citation ID:
RRID:MMRRC_067755-MU
Other Names:
R8390 (G1)
Major Collection:

Strain Information

Pitx2
Name: paired-like homeodomain transcription factor 2
Synonyms: Otlx2, Brx1b, Brx1a, Brx1, solurshin, Ptx2, Munc30, Pitx2c, Pitx2b, Pitx2a, Rieg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18741
HGNC: HGNC:9005
Homologene: 55454
Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Zfp553
Name: zinc finger protein 553
Synonyms: C330013F15Rik, 2600009K23Rik, ENSMUSG00000054461
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233887
Homologene: 27098
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, 3110054G10Rik, D130023A07Rik, 2010321I05Rik, Tnrc6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233833
Homologene: 41399
Brix1
Name: BRX1, biogenesis of ribosomes
Synonyms: 1110064N10Rik, Bxdc2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67832
Homologene: 10133
Psmd1
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Synonyms: P112, S1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70247
HGNC: HGNC:9554
Homologene: 2100
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
Ipo13
Name: importin 13
Synonyms: Kap13, Imp13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230673
Homologene: 40968
Mepce
Name: methylphosphate capping enzyme
Synonyms: D5Wsu46e, Bcdin3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231803
Homologene: 32447
Pot1b
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Csnk1g3
Name: casein kinase 1, gamma 3
Synonyms: 3300002K07Rik, C330049O21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70425
VEGA: 18
HGNC: HGNC:2456
Homologene: 121650
Kcnh5
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238271
VEGA: 12
HGNC: HGNC:6254
Homologene: 15858
Lmbr1
Name: limb region 1
Synonyms: 1110048D14Rik, C79130
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56873
Homologene: 49706
Nlrp3
Name: NLR family, pyrin domain containing 3
Synonyms: NALP3, Pypaf1, Cias1, Mmig1, cryopyrin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216799
Homologene: 3600
Hsd17b13
Name: hydroxysteroid (17-beta) dehydrogenase 13
Synonyms: Pan1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243168
Homologene: 71549
Elavl1
Name: ELAV like RNA binding protein 1
Synonyms: Hua, 2410055N02Rik, W91709, HuR, ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15568
HGNC: HGNC:3312
Homologene: 20367
Foxn3
Name: forkhead box N3
Synonyms: HTLFL1, 5430426H20Rik, Ches1l, Ches1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71375
HGNC: HGNC:1928
Homologene: 135955
Wdr19
Name: WD repeat domain 19
Synonyms: C330027H04Rik, D330023L08Rik, Ift144, DYF2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213081
Homologene: 11842
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5c, Nav1.5, mH1, SkM2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Ciz1
Name: CDKN1A interacting zinc finger protein 1
Synonyms: 0610038H21Rik, 2900056O04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68379
Homologene: 8112
Mtpap
Name: mitochondrial poly(A) polymerase
Synonyms: 0610027A18Rik, Papd1, Tent6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67440
VEGA: 18
Homologene: 10008
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Me3
Name: malic enzyme 3, NADP(+)-dependent, mitochondrial
Synonyms: B230207H15Rik, 1700020C08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 109264
HGNC: HGNC:6985
Homologene: 100773
Ifi207
Name: interferon activated gene 207
Synonyms: AI607873, Pyhin-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226691
HGNC: HGNC:5395
Homologene: 115929
Abca9
Name: ATP-binding cassette, sub-family A member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217262
HGNC: HGNC:39
Homologene: 33332
Ifi206
Name: interferon activated gene 206
Synonyms: Gm4955, Pyblhin-C
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102639543
Homologene: 115929
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Or8h10
Name: olfactory receptor family 8 subfamily H member 10
Synonyms: GA_x6K02T2Q125-48465387-48464422, MOR206-4, Olfr1100
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258587
Homologene: 34954
Tmem236
Name: transmembrane protein 236
Synonyms: 2010003H20Rik, Fam23a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 625286
Homologene: 46598
Tnk1
Name: tyrosine kinase, non-receptor, 1
Synonyms: Kos1, Tnk1b, Tnk1a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83813
Homologene: 2966
Or13a19
Name: olfactory receptor family 13 subfamily A member 19
Synonyms: GA_x6K02T2PBJ9-42472898-42473827, MOR251-2, Olfr525
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258958
Homologene: 138321
Or5al7
Name: olfactory receptor family 5 subfamily AL member 7
Synonyms: GA_x6K02T2Q125-47631900-47630956, MOR185-7, Olfr1043
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258570
Homologene: 88364
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 21674
Zfp62
Name: zinc finger protein 62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22720
Homologene: 40686
Neil3
Name: nei like 3 (E. coli)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234258
Homologene: 10094
Or2d2
Name: olfactory receptor family 2 subfamily D member 2
Synonyms: GA_x6K02T2PBJ9-9479517-9478573, MOR260-1, Olfr715
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258776
HGNC: HGNC:8244
Homologene: 81541
H2-M10.5
Name: histocompatibility 2, M region locus 10.5
Synonyms: 6.9H
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224761
Homologene: 117973
Tex47
Name: testis expressed 47
Synonyms: 4921511H03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70920
Homologene: 41723
Smtnl1
Name: smoothelin-like 1
Synonyms: 1110030K22Rik, Chasm
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68678
Homologene: 11488
Iqcf3
Name: IQ motif containing F3
Synonyms: 1700012F17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68265
Homologene: 86789
Or8b49
Name: olfactory receptor family 8 subfamily B member 49
Synonyms: GA_x6K02T2PVTD-32296575-32297513, MOR165-9P, MOR165-10, Olfr913
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258225
VEGA: 9
Homologene: 79398
Myl12a
Name: myosin, light chain 12A, regulatory, non-sarcomeric
Synonyms: brain specific myosin regulatory light chain, NMDA receptor-interacting protein, 2900073G15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67268
Homologene: 68515
C1d
Name: C1D nuclear receptor co-repressor
Synonyms: SUN-CoR, 1110036E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57316
Homologene: 4619
Timd6
Name: T cell immunoglobulin and mucin domain containing 6
Synonyms: BC053393
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 407814
Homologene: 86792
Trav6d-4
Name: T cell receptor alpha variable 6D-4
Synonyms: LOC193570, LOC277146
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 277146
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 86,078,607 bp
  • G to T, chromosome 1 at 173,480,945 bp
  • GTT to GT, chromosome 1 at 173,729,450 bp
  • T to C, chromosome 2 at 14,219,357 bp
  • G to T, chromosome 2 at 32,367,323 bp
  • A to G, chromosome 2 at 52,110,923 bp
  • A to T, chromosome 2 at 84,815,350 bp
  • A to G, chromosome 2 at 86,162,922 bp
  • G to A, chromosome 2 at 86,978,157 bp
  • A to T, chromosome 2 at 175,130,812 bp
  • C to A, chromosome 3 at 129,218,858 bp
  • A to T, chromosome 4 at 117,912,337 bp
  • G to A, chromosome 5 at 7,305,301 bp
  • C to T, chromosome 5 at 29,235,042 bp
  • T to A, chromosome 5 at 65,223,867 bp
  • T to C, chromosome 5 at 81,766,210 bp
  • C to A, chromosome 5 at 103,972,646 bp
  • A to T, chromosome 5 at 113,692,780 bp
  • A to G, chromosome 5 at 137,785,179 bp
  • T to TCCC, chromosome 6 at 4,756,451 bp
  • G to A, chromosome 6 at 48,467,962 bp
  • G to T, chromosome 7 at 89,849,595 bp
  • A to G, chromosome 7 at 107,129,315 bp
  • A to G, chromosome 7 at 123,162,571 bp
  • A to G, chromosome 7 at 127,236,304 bp
  • G to T, chromosome 7 at 140,323,114 bp
  • T to A, chromosome 8 at 4,289,623 bp
  • A to T, chromosome 8 at 53,609,524 bp
  • T to A, chromosome 9 at 38,594,591 bp
  • T to G, chromosome 9 at 106,560,976 bp
  • T to A, chromosome 9 at 119,539,538 bp
  • G to A, chromosome 10 at 11,187,983 bp
  • T to C, chromosome 11 at 17,263,993 bp
  • G to T, chromosome 11 at 46,577,255 bp
  • G to A, chromosome 11 at 49,215,192 bp
  • A to T, chromosome 11 at 59,002,044 bp
  • A to G, chromosome 11 at 59,551,790 bp
  • T to C, chromosome 11 at 69,851,869 bp
  • A to T, chromosome 11 at 110,145,630 bp
  • T to A, chromosome 12 at 75,087,758 bp
  • T to A, chromosome 12 at 99,388,741 bp
  • A to T, chromosome 14 at 52,753,635 bp
  • C to T, chromosome 15 at 10,485,868 bp
  • T to A, chromosome 17 at 36,774,595 bp
  • C to A, chromosome 17 at 55,692,739 bp
  • T to C, chromosome 17 at 70,996,236 bp
  • T to A, chromosome 18 at 4,396,141 bp
  • A to T, chromosome 18 at 53,948,078 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8390 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067755-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.