Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8392Btlr/Mmmh
Stock Number:
067757-MU
Citation ID:
RRID:MMRRC_067757-MU
Other Names:
R8392 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Top1
Name: topoisomerase (DNA) I
Synonyms: Top-1, D130064I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21969
Homologene: 2467
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Kdsr
Name: 3-ketodihydrosphingosine reductase
Synonyms: 6330410P18Rik, 9430079B08Rik, Fvt1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70750
HGNC: HGNC:4021
Homologene: 1539
Erbin
Name: Erbb2 interacting protein
Synonyms: 1700028E05Rik, Erbin, Erbb2ip
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 59079
Homologene: 41282
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 106,743,853 bp
  • A to G, chromosome 1 at 127,938,633 bp
  • T to A, chromosome 2 at 17,452,552 bp
  • T to G, chromosome 2 at 36,870,340 bp
  • T to C, chromosome 2 at 59,806,307 bp
  • T to C, chromosome 2 at 60,349,940 bp
  • T to A, chromosome 2 at 160,717,454 bp
  • A to T, chromosome 4 at 58,070,566 bp
  • C to T, chromosome 4 at 115,529,478 bp
  • G to A, chromosome 4 at 125,066,825 bp
  • G to A, chromosome 5 at 81,646,550 bp
  • A to G, chromosome 5 at 151,042,162 bp
  • T to C, chromosome 6 at 5,143,491 bp
  • T to A, chromosome 6 at 125,880,735 bp
  • C to T, chromosome 7 at 27,372,296 bp
  • A to T, chromosome 7 at 88,297,243 bp
  • G to GACGGCGGCC, chromosome 7 at 97,579,909 bp
  • A to G, chromosome 7 at 105,703,343 bp
  • T to A, chromosome 8 at 11,208,333 bp
  • A to C, chromosome 8 at 63,355,311 bp
  • T to A, chromosome 9 at 24,310,081 bp
  • T to A, chromosome 9 at 103,355,275 bp
  • T to C, chromosome 9 at 121,915,234 bp
  • A to T, chromosome 10 at 26,845,940 bp
  • T to G, chromosome 10 at 92,962,417 bp
  • A to G, chromosome 10 at 94,801,490 bp
  • T to A, chromosome 10 at 129,738,041 bp
  • T to C, chromosome 11 at 69,683,862 bp
  • T to A, chromosome 11 at 72,403,167 bp
  • C to A, chromosome 11 at 74,900,270 bp
  • A to T, chromosome 11 at 82,036,982 bp
  • T to A, chromosome 12 at 24,990,728 bp
  • T to A, chromosome 12 at 36,390,498 bp
  • T to A, chromosome 12 at 54,923,123 bp
  • T to C, chromosome 13 at 6,549,660 bp
  • C to T, chromosome 13 at 21,716,486 bp
  • T to A, chromosome 13 at 103,834,062 bp
  • T to C, chromosome 14 at 26,885,912 bp
  • A to G, chromosome 14 at 44,858,922 bp
  • G to A, chromosome 16 at 4,084,281 bp
  • G to A, chromosome 16 at 33,799,419 bp
  • G to A, chromosome 16 at 36,722,358 bp
  • G to T, chromosome 16 at 36,722,359 bp
  • A to G, chromosome 16 at 57,571,353 bp
  • T to A, chromosome 18 at 37,006,159 bp
  • TTGCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG, chromosome 19 at 37,174,891 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8392 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067757-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.