Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8400Btlr/Mmmh
Stock Number:
067763-MU
Citation ID:
RRID:MMRRC_067763-MU
Other Names:
R8400 (G1)
Major Collection:

Strain Information

Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 1810033J14Rik, D230038D11Rik, 9530077A04Rik, Mll5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Spc24
Name: SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms: 2410030K01Rik, Spbc24
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67629
VEGA: 9
Homologene: 12166
Csnk1g3
Name: casein kinase 1, gamma 3
Synonyms: 3300002K07Rik, C330049O21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70425
VEGA: 18
HGNC: HGNC:2456
Homologene: 121650
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Fam185a
Name: family with sequence similarity 185, member A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330050
Homologene: 51828
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 63,304,976 bp
  • C to A, chromosome 1 at 130,636,747 bp
  • C to T, chromosome 1 at 158,657,100 bp
  • T to A, chromosome 1 at 172,234,494 bp
  • T to C, chromosome 2 at 19,658,378 bp
  • A to G, chromosome 2 at 30,473,093 bp
  • A to T, chromosome 2 at 111,565,402 bp
  • T to C, chromosome 2 at 157,099,433 bp
  • G to A, chromosome 4 at 45,864,905 bp
  • T to C, chromosome 4 at 155,772,768 bp
  • T to A, chromosome 5 at 21,438,816 bp
  • C to A, chromosome 5 at 23,497,092 bp
  • A to G, chromosome 5 at 121,626,205 bp
  • A to T, chromosome 6 at 123,637,527 bp
  • T to A, chromosome 7 at 20,024,012 bp
  • A to T, chromosome 7 at 22,789,880 bp
  • A to T, chromosome 7 at 26,565,006 bp
  • A to G, chromosome 7 at 87,002,100 bp
  • A to T, chromosome 7 at 101,253,573 bp
  • T to A, chromosome 7 at 106,689,669 bp
  • C to G, chromosome 7 at 131,082,587 bp
  • C to T, chromosome 7 at 139,913,518 bp
  • C to A, chromosome 7 at 141,810,476 bp
  • T to C, chromosome 8 at 80,709,127 bp
  • C to T, chromosome 8 at 109,623,888 bp
  • T to C, chromosome 8 at 125,232,993 bp
  • A to T, chromosome 9 at 19,713,093 bp
  • A to T, chromosome 9 at 21,757,730 bp
  • T to C, chromosome 9 at 54,383,753 bp
  • A to C, chromosome 9 at 105,774,796 bp
  • TGTCACAGGT to TGT, chromosome 10 at 80,866,069 bp
  • GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT, chromosome 10 at 116,283,572 bp
  • G to A, chromosome 11 at 9,293,925 bp
  • T to C, chromosome 11 at 9,298,218 bp
  • C to T, chromosome 11 at 74,206,395 bp
  • T to C, chromosome 12 at 38,602,838 bp
  • G to A, chromosome 13 at 21,703,915 bp
  • C to A, chromosome 13 at 50,643,417 bp
  • T to C, chromosome 15 at 20,666,172 bp
  • A to T, chromosome 17 at 24,604,987 bp
  • A to C, chromosome 17 at 24,884,465 bp
  • C to T, chromosome 17 at 35,470,477 bp
  • T to C, chromosome 17 at 80,216,005 bp
  • T to A, chromosome 18 at 37,092,400 bp
  • C to T, chromosome 18 at 53,953,288 bp
  • T to A, chromosome 19 at 11,871,214 bp
  • T to C, chromosome 19 at 43,753,205 bp
  • G to A, chromosome 19 at 56,848,649 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8400 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067763-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.