Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8416Btlr/Mmmh
Stock Number:
067770-MU
Citation ID:
RRID:MMRRC_067770-MU
Other Names:
R8416 (G1)
Major Collection:

Strain Information

Zmpste24
Name: zinc metallopeptidase, STE24
Synonyms: A530043O15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230709
Homologene: 4277
Npc2
Name: NPC intracellular cholesterol transporter 2
Synonyms: HE1, 2700012J19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67963
VEGA: 12
Homologene: 4697
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Rtn4rl2
Name: reticulon 4 receptor-like 2
Synonyms: Ngr2, Ngrh1, Ngrl3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269295
Homologene: 18683
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: DDF1, PARP7, PARP-7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99929
Homologene: 9167
Srpk1
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20815
Homologene: 110962
Pde1b
Name: phosphodiesterase 1B, Ca2+-calmodulin dependent
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18574
VEGA: 15
HGNC: HGNC:8775
Homologene: 37370
Asap1
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain1
Synonyms: Ddef1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13196
HGNC: HGNC:2720
Homologene: 7684
Agps
Name: alkylglycerone phosphate synthase
Synonyms: ADAPS, 9930035G10Rik, bs2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228061
HGNC: HGNC:327
Homologene: 2716
Rps15
Name: ribosomal protein S15
Synonyms: rat insulinoma gene, rig, insulinoma
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20054
Homologene: 110643
Parp4
Name: poly (ADP-ribose) polymerase family, member 4
Synonyms: VPARP, VAULT3, p193, PH5P, E230037B21Rik, Adprtl1, C030027K23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328417
HGNC: HGNC:271
Homologene: 124423
Cdh19
Name: cadherin 19, type 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227485
HGNC: HGNC:1758
Homologene: 23286
Flrt2
Name: fibronectin leucine rich transmembrane protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 399558
HGNC: HGNC:3761
Homologene: 8291
Abcf3
Name: ATP-binding cassette, sub-family F member 3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27406
HGNC: HGNC:72
Homologene: 22784
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68187
Homologene: 32665
Susd6
Name: sushi domain containing 6
Synonyms: 4933426M11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217684
VEGA: 12
Homologene: 40980
Mctp2
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244049
Homologene: 69254
Wdr11
Name: WD repeat domain 11
Synonyms: 2900055P10Rik, Wdr11, Brwd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207425
Homologene: 41229
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110876
Homologene: 75001
Elac1
Name: elaC ribonuclease Z 1
Synonyms: 8430417G19Rik, 2610018O07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 114615
Homologene: 10272
Irf2
Name: interferon regulatory factor 2
Synonyms: Irf-2, 9830146E22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16363
HGNC: HGNC:6117
Homologene: 1659
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Gjc2
Name: gap junction protein, gamma 2
Synonyms: connexin 47, Cx47, B230382L12Rik, Gja12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 118454
Homologene: 10715
Dgkz
Name: diacylglycerol kinase zeta
Synonyms: mDGK[z], E130307B02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104418
HGNC: HGNC:2857
Homologene: 37831
Tmprss11c
Name: transmembrane protease, serine 11c
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 435845
Homologene: 78847
Zdhhc23
Name: zinc finger, DHHC domain containing 23
Synonyms: LOC332175, LOC385651
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 332175
VEGA: 16
Homologene: 17840
Ccdc83
Name: coiled-coil domain containing 83
Synonyms: 4930549K11Rik, 4930554C01Rik, 4932423M01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75338
Homologene: 32709
Jmy
Name: junction-mediating and regulatory protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 57748
VEGA: 13
Homologene: 10955
Clca3a1
Name: chloride channel accessory 3A1
Synonyms: Clca1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12722
HGNC: HGNC:2017
Homologene: 77224
Sh3tc1
Name: SH3 domain and tetratricopeptide repeats 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231147
Homologene: 10360
Ptpru
Name: protein tyrosine phosphatase receptor type U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19273
HGNC: HGNC:9683
Homologene: 4168
Cxcr5
Name: C-X-C motif chemokine receptor 5
Synonyms: Gpcr6, CXCR-5, Blr1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12145
VEGA: 9
HGNC: HGNC:1060
Homologene: 1298
Pou2f2
Name: POU domain, class 2, transcription factor 2
Synonyms: Oct2b, Oct2a, Otf-2, Oct-2, Otf2, Oct2d, Oct2c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18987
HGNC: HGNC:9213
Homologene: 55674
Thoc5
Name: THO complex 5
Synonyms: PK1.3, 1700060C24Rik, Fmip, A430085L24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107829
Homologene: 37836
Or5b119
Name: olfactory receptor family 5 subfamily B member 119
Synonyms: GA_x6K02T2RE5P-3812807-3811863, MOR202-36, Olfr1475
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258298
Homologene: 77370
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Zfp488
Name: zinc finger protein 488
Synonyms: LOC382867
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 382867
Homologene: 17688
Sult1c1
Name: sulfotransferase family, cytosolic, 1C, member 1
Synonyms: (PST)G, mOLFST, P-SULT, Stp2, Sult1a2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20888
Homologene: 56817
Csnk2a2ip
Name: casein kinase 2, alpha prime interacting protein
Synonyms: Ckt2, Csnka2ip
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224291
Homologene: 77570
Uck1
Name: uridine-cytidine kinase 1
Synonyms: URK1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22245
Homologene: 7990
Fbxo10
Name: F-box protein 10
Synonyms: FBX10, LOC269529
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269529
Homologene: 19544
Mboat2
Name: membrane bound O-acyltransferase domain containing 2
Synonyms: 2810049G06Rik, Oact2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67216
VEGA: 12
Homologene: 6971
Amz1
Name: archaelysin family metallopeptidase 1
Synonyms: 6530401C20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231842
Homologene: 18290
Bhmt1b
Name: betaine--homocysteine S-methyltransferase 1B
Synonyms: Gm5096
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329008
VEGA: 18
HGNC: HGNC:1047
Slc7a9
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 9
Synonyms: CSNU3, bo, +AT, bo, + amino acid transporter
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30962
Homologene: 56668
Lsm11
Name: U7 snRNP-specific Sm-like protein LSM11
Synonyms: 2210404M20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72290
Homologene: 32693
Defb33
Name: defensin beta 33
Synonyms: EG654453
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 654453
Cnpy1
Name: canopy FGF signaling regulator 1
Synonyms: 9630008K15Rik, 1500012D20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269637
Homologene: 89678
Or2t29
Name: olfactory receptor family 2 subfamily T member 29
Synonyms: GA_x6K02T2NKPP-882068-883006, MOR275-6P, Olfr329-ps, Olfr329
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259148
Homologene: 133015
Pcdhga2
Name: protocadherin gamma subfamily A, 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93710
HGNC: HGNC:8700
Homologene: 69262
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 24,028,594 bp
  • A to T, chromosome 1 at 110,925,880 bp
  • C to A, chromosome 2 at 31,391,076 bp
  • C to A, chromosome 2 at 32,260,141 bp
  • A to C, chromosome 2 at 65,681,001 bp
  • A to G, chromosome 2 at 75,854,203 bp
  • C to T, chromosome 2 at 84,872,607 bp
  • A to T, chromosome 2 at 91,940,304 bp
  • A to G, chromosome 3 at 65,531,346 bp
  • C to A, chromosome 3 at 144,755,153 bp
  • C to T, chromosome 4 at 43,540,116 bp
  • T to A, chromosome 4 at 45,058,942 bp
  • T to C, chromosome 4 at 121,083,359 bp
  • C to T, chromosome 4 at 131,808,472 bp
  • T to C, chromosome 5 at 28,203,425 bp
  • G to A, chromosome 5 at 35,710,912 bp
  • T to G, chromosome 5 at 66,999,306 bp
  • T to G, chromosome 5 at 86,239,417 bp
  • G to A, chromosome 5 at 140,751,976 bp
  • C to T, chromosome 6 at 56,151,291 bp
  • G to T, chromosome 7 at 25,116,126 bp
  • A to G, chromosome 7 at 35,453,433 bp
  • T to C, chromosome 7 at 72,202,462 bp
  • A to T, chromosome 7 at 90,236,305 bp
  • G to A, chromosome 7 at 129,630,679 bp
  • T to A, chromosome 8 at 20,897,635 bp
  • A to T, chromosome 8 at 46,818,852 bp
  • A to T, chromosome 9 at 44,514,286 bp
  • A to G, chromosome 10 at 80,292,790 bp
  • T to A, chromosome 11 at 4,926,068 bp
  • A to T, chromosome 11 at 35,508,235 bp
  • A to T, chromosome 11 at 45,933,903 bp
  • A to T, chromosome 11 at 58,542,952 bp
  • A to T, chromosome 11 at 59,177,508 bp
  • G to A, chromosome 12 at 24,934,610 bp
  • T to A, chromosome 12 at 80,851,223 bp
  • A to G, chromosome 12 at 84,765,357 bp
  • A to G, chromosome 12 at 95,779,557 bp
  • T to C, chromosome 13 at 93,498,441 bp
  • A to G, chromosome 14 at 33,971,095 bp
  • T to C, chromosome 14 at 56,587,814 bp
  • A to T, chromosome 15 at 64,130,223 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • G to A, chromosome 15 at 103,515,318 bp
  • A to G, chromosome 16 at 20,550,273 bp
  • A to T, chromosome 16 at 43,971,564 bp
  • T to C, chromosome 16 at 64,479,932 bp
  • A to G, chromosome 17 at 28,594,255 bp
  • A to T, chromosome 17 at 53,962,552 bp
  • A to T, chromosome 18 at 37,670,125 bp
  • A to G, chromosome 18 at 73,738,856 bp
  • T to C, chromosome 18 at 87,756,563 bp
  • A to T, chromosome 19 at 13,479,400 bp
  • G to A, chromosome 19 at 38,772,997 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8416 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067770-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.