Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8416Btlr/Mmmh
Stock Number:
067770-MU
Citation ID:
RRID:MMRRC_067770-MU
Other Names:
R8416 (G1)
Major Collection:

Strain Information

Zmpste24
Name: zinc metallopeptidase, STE24
Synonyms: A530043O15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230709
Homologene: 4277
Npc2
Name: NPC intracellular cholesterol transporter 2
Synonyms: HE1, 2700012J19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67963
VEGA: 12
Homologene: 4697
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Rtn4rl2
Name: reticulon 4 receptor-like 2
Synonyms: Ngr2, Ngrh1, Ngrl3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269295
Homologene: 18683
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: DDF1, PARP-7, PARP7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99929
Homologene: 9167
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 24,028,594 bp
  • A to T, chromosome 1 at 110,925,880 bp
  • C to A, chromosome 2 at 31,391,076 bp
  • C to A, chromosome 2 at 32,260,141 bp
  • A to C, chromosome 2 at 65,681,001 bp
  • A to G, chromosome 2 at 75,854,203 bp
  • C to T, chromosome 2 at 84,872,607 bp
  • A to T, chromosome 2 at 91,940,304 bp
  • A to G, chromosome 3 at 65,531,346 bp
  • C to A, chromosome 3 at 144,755,153 bp
  • C to T, chromosome 4 at 43,540,116 bp
  • T to A, chromosome 4 at 45,058,942 bp
  • T to C, chromosome 4 at 121,083,359 bp
  • C to T, chromosome 4 at 131,808,472 bp
  • T to C, chromosome 5 at 28,203,425 bp
  • G to A, chromosome 5 at 35,710,912 bp
  • T to G, chromosome 5 at 66,999,306 bp
  • T to G, chromosome 5 at 86,239,417 bp
  • G to A, chromosome 5 at 140,751,976 bp
  • C to T, chromosome 6 at 56,151,291 bp
  • G to T, chromosome 7 at 25,116,126 bp
  • A to G, chromosome 7 at 35,453,433 bp
  • T to C, chromosome 7 at 72,202,462 bp
  • A to T, chromosome 7 at 90,236,305 bp
  • G to A, chromosome 7 at 129,630,679 bp
  • T to A, chromosome 8 at 20,897,635 bp
  • A to T, chromosome 8 at 46,818,852 bp
  • A to T, chromosome 9 at 44,514,286 bp
  • A to G, chromosome 10 at 80,292,790 bp
  • T to A, chromosome 11 at 4,926,068 bp
  • A to T, chromosome 11 at 35,508,235 bp
  • A to T, chromosome 11 at 45,933,903 bp
  • A to T, chromosome 11 at 58,542,952 bp
  • A to T, chromosome 11 at 59,177,508 bp
  • G to A, chromosome 12 at 24,934,610 bp
  • T to A, chromosome 12 at 80,851,223 bp
  • A to G, chromosome 12 at 84,765,357 bp
  • A to G, chromosome 12 at 95,779,557 bp
  • T to C, chromosome 13 at 93,498,441 bp
  • A to G, chromosome 14 at 33,971,095 bp
  • T to C, chromosome 14 at 56,587,814 bp
  • A to T, chromosome 15 at 64,130,223 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • G to A, chromosome 15 at 103,515,318 bp
  • A to G, chromosome 16 at 20,550,273 bp
  • A to T, chromosome 16 at 43,971,564 bp
  • T to C, chromosome 16 at 64,479,932 bp
  • A to G, chromosome 17 at 28,594,255 bp
  • A to T, chromosome 17 at 53,962,552 bp
  • A to T, chromosome 18 at 37,670,125 bp
  • A to G, chromosome 18 at 73,738,856 bp
  • T to C, chromosome 18 at 87,756,563 bp
  • A to T, chromosome 19 at 13,479,400 bp
  • G to A, chromosome 19 at 38,772,997 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8416 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067770-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.