Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8298Btlr/Mmmh
Stock Number:
067786-MU
Citation ID:
RRID:MMRRC_067786-MU
Other Names:
R8298 (G1)
Major Collection:

Strain Information

Sh3gl2
Name: SH3-domain GRB2-like 2
Synonyms: EEN-B1, endophilin I, Sh3d2a, 9530001L19Rik, B930049H17Rik, endophilin A1, EEN1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20404
Homologene: 20652
Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Dyrk3
Name: dual-specificity tyrosine phosphorylation regulated kinase 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226419
HGNC: HGNC:3094
Homologene: 55762
Usp1
Name: ubiquitin specific peptidase 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230484
Homologene: 2528
Prpf4b
Name: pre-mRNA processing factor 4B
Synonyms: Prp4, Prpk, Prp4k
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19134
VEGA: 13
Homologene: 134085
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 80,536,937 bp
  • C to T, chromosome 1 at 131,129,375 bp
  • C to A, chromosome 1 at 171,358,861 bp
  • A to T, chromosome 1 at 174,247,387 bp
  • T to C, chromosome 2 at 36,813,026 bp
  • C to A, chromosome 2 at 76,727,167 bp
  • T to C, chromosome 2 at 85,850,189 bp
  • A to T, chromosome 2 at 87,711,032 bp
  • T to A, chromosome 2 at 164,950,359 bp
  • A to T, chromosome 3 at 92,135,620 bp
  • T to C, chromosome 3 at 92,825,300 bp
  • T to C, chromosome 3 at 127,615,229 bp
  • T to C, chromosome 4 at 3,605,840 bp
  • T to A, chromosome 4 at 32,640,429 bp
  • T to A, chromosome 4 at 85,379,410 bp
  • T to A, chromosome 4 at 98,930,899 bp
  • A to C, chromosome 4 at 104,948,831 bp
  • T to A, chromosome 4 at 148,658,093 bp
  • A to G, chromosome 5 at 8,412,115 bp
  • T to C, chromosome 5 at 26,001,150 bp
  • G to A, chromosome 5 at 107,816,865 bp
  • A to T, chromosome 5 at 147,024,517 bp
  • T to A, chromosome 6 at 86,925,079 bp
  • T to A, chromosome 7 at 7,182,815 bp
  • A to G, chromosome 7 at 8,908,149 bp
  • A to G, chromosome 7 at 45,360,194 bp
  • T to C, chromosome 7 at 49,554,261 bp
  • A to G, chromosome 7 at 49,857,438 bp
  • T to C, chromosome 7 at 75,747,804 bp
  • T to C, chromosome 7 at 98,098,334 bp
  • T to C, chromosome 8 at 27,198,558 bp
  • A to G, chromosome 8 at 110,600,383 bp
  • A to G, chromosome 8 at 124,728,372 bp
  • C to T, chromosome 9 at 44,798,819 bp
  • A to T, chromosome 9 at 53,594,424 bp
  • A to G, chromosome 9 at 64,906,875 bp
  • T to C, chromosome 9 at 100,985,832 bp
  • T to C, chromosome 9 at 108,566,921 bp
  • A to T, chromosome 10 at 26,245,570 bp
  • A to G, chromosome 10 at 41,389,058 bp
  • A to T, chromosome 10 at 61,475,583 bp
  • A to G, chromosome 10 at 78,202,919 bp
  • T to C, chromosome 11 at 50,777,131 bp
  • T to A, chromosome 11 at 80,246,676 bp
  • G to A, chromosome 12 at 4,206,482 bp
  • C to T, chromosome 12 at 76,577,078 bp
  • T to C, chromosome 12 at 104,476,177 bp
  • C to T, chromosome 12 at 108,652,973 bp
  • T to C, chromosome 13 at 27,661,011 bp
  • A to G, chromosome 13 at 34,888,183 bp
  • G to A, chromosome 13 at 48,498,377 bp
  • A to T, chromosome 13 at 62,518,481 bp
  • A to G, chromosome 13 at 67,040,912 bp
  • A to T, chromosome 13 at 81,385,914 bp
  • T to C, chromosome 14 at 42,640,718 bp
  • T to C, chromosome 15 at 74,813,692 bp
  • T to C, chromosome 15 at 101,624,170 bp
  • T to A, chromosome 16 at 63,566,598 bp
  • A to G, chromosome 16 at 64,766,332 bp
  • C to T, chromosome 16 at 72,972,132 bp
  • T to C, chromosome 17 at 24,385,401 bp
  • A to T, chromosome 17 at 87,797,285 bp
  • A to G, chromosome 17 at 90,704,169 bp
  • G to A, chromosome 18 at 12,525,853 bp
  • A to T, chromosome 18 at 62,178,682 bp
  • A to G, chromosome 19 at 6,850,281 bp
  • AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA to AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA, chromosome X at 135,745,704 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8298 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067786-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.