Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8298Btlr/Mmmh
Stock Number:
067786-MU
Citation ID:
RRID:MMRRC_067786-MU
Other Names:
R8298 (G1)
Major Collection:

Strain Information

Sh3gl2
Name: SH3-domain GRB2-like 2
Synonyms: EEN-B1, endophilin I, Sh3d2a, 9530001L19Rik, B930049H17Rik, endophilin A1, EEN1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20404
Homologene: 20652
Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Zfp934
Name: zinc finger protein 934
Synonyms: 6720457D02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77117
VEGA: 13
Dyrk3
Name: dual-specificity tyrosine phosphorylation regulated kinase 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226419
HGNC: HGNC:3094
Homologene: 55762
Usp1
Name: ubiquitin specific peptidase 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230484
Homologene: 2528
Prpf4b
Name: pre-mRNA processing factor 4B
Synonyms: Prp4, Prpk, Prp4k
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19134
VEGA: 13
Homologene: 134085
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Evi5
Name: ecotropic viral integration site 5
Synonyms: NB4S
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14020
HGNC: HGNC:3501
Homologene: 121902
Prmt3
Name: protein arginine N-methyltransferase 3
Synonyms: 2410018A17Rik, 2010005E20Rik, Hrmt1l3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71974
Homologene: 24255
Zgrf1
Name: zinc finger, GRF-type containing 1
Synonyms: 4930422G04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71643
Homologene: 34708
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Dbf4
Name: DBF4 zinc finger
Synonyms: Ask
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27214
Homologene: 40892
Trappc10
Name: trafficking protein particle complex 10
Synonyms: LOC380642, B230307C21Rik, Tmem1, b2b2416Clo, b2b2613Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216131
VEGA: 10
Homologene: 37751
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19876
Homologene: 2206
Rhot1
Name: ras homolog family member T1
Synonyms: Miro1, 2210403N23Rik, FLJ11040, Arht1, C430039G08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 59040
Homologene: 56803
Aak1
Name: AP2 associated kinase 1
Synonyms: 5530400K14Rik, D6Ertd245e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269774
Homologene: 128746
Casp8ap2
Name: caspase 8 associated protein 2
Synonyms: D4Ertd659e, FLASH
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26885
HGNC: HGNC:1510
Homologene: 8066
Zfp169
Name: zinc finger protein 169
Synonyms: 4930429A13Rik, 1700025J14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67911
Homologene: 2572
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Abca3
Name: ATP-binding cassette, sub-family A member 3
Synonyms: ABC-C, Abc3, 1810036E22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27410
HGNC: HGNC:33
Homologene: 37437
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Zfp418
Name: zinc finger protein 418
Synonyms: A230102I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232854
Homologene: 119890
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Mmp9
Name: matrix metallopeptidase 9
Synonyms: gelatinase B, Gel B, MMP-9, B/MMP9, Clg4b, Gelatinase B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17395
HGNC: HGNC:7176
Homologene: 3659
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Dennd4a
Name: DENN domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102442
VEGA: 9
Homologene: 55933
Adcy3
Name: adenylate cyclase 3
Synonyms: AC3, ACIII
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104111
HGNC: HGNC:234
Homologene: 2978
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, Jr4, ZIZ3, 9330153B10Rik, A630054M16Rik, Zizimin3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Got1l1
Name: glutamic-oxaloacetic transaminase 1-like 1
Synonyms: 1700083M11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76615
Homologene: 65045
Ccdc88b
Name: coiled-coil domain containing 88B
Synonyms: 2610041P08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78317
VEGA: 19
Homologene: 49992
Samd3
Name: sterile alpha motif domain containing 3
Synonyms: LOC268288
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268288
VEGA: 10
Homologene: 67991
Adamts2
Name: ADAM metallopeptidase with thrombospondin type 1 motif 2
Synonyms: ADAM-TS2, hPCPNI, a disintegrin and metalloproteinase with thrombospondin repeats, procollagen N-proteinase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216725
HGNC: HGNC:218
Homologene: 8597
Lnx2
Name: ligand of numb-protein X 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140887
Homologene: 17737
Ak9
Name: adenylate kinase 9
Synonyms: LOC215946, Akd2, Gm7127, Akd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 633979
Homologene: 67934
Kprp
Name: keratinocyte expressed, proline-rich
Synonyms: 1110001M24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433619
Homologene: 54921
Zfp712
Name: zinc finger protein 712
Synonyms: 4921504N20Rik, mszf31, mszf89
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78251
VEGA: 13
Homologene: 136296
Adrb2
Name: adrenergic receptor, beta 2
Synonyms: beta 2-AR, Badm, Adrb-2, beta 2-adrenoceptor, Gpcr7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11555
VEGA: 18
HGNC: HGNC:286
Homologene: 30948
Nrxn1
Name: neurexin I
Synonyms: alpha-latrotoxin receptor (calcium-dependent), neurexin I beta, neurexin I alpha, neurexin I beta, neurexin I beta, neurexin I alpha, neurexin I alpha, 1700062G21Rik, A230068P09Rik, 9330127H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Tgs1
Name: trimethylguanosine synthase 1
Synonyms: Pimt, D4Ertd800e, Ncoa6ip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 116940
Homologene: 32608
Ppfia3
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms: 2410127E16Rik, Liprin-alpha3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76787
HGNC: HGNC:9247
Homologene: 37833
Plekhg3
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 3
Synonyms: MGC40768
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 263406
VEGA: 12
Homologene: 77478
Klhdc9
Name: kelch domain containing 9
Synonyms: ESTM31, 1190002J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68874
Homologene: 66637
Or5ap2
Name: olfactory receptor family 5 subfamily AP member 2
Synonyms: GA_x6K02T2Q125-47327964-47328917, MOR201-2, Olfr1020
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258573
Homologene: 45007
Or5w14
Name: olfactory receptor family 5 subfamily W member 14
Synonyms: GA_x6K02T2Q125-49215724-49214792, MOR40-9P, MOR177-20, Olfr1137
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258101
Homologene: 79380
Tmem25
Name: transmembrane protein 25
Synonyms: 0610039J01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71687
Homologene: 12403
Pccb
Name: propionyl Coenzyme A carboxylase, beta polypeptide
Synonyms: 1300012P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66904
HGNC: HGNC:8654
Homologene: 447
Or1j1
Name: olfactory receptor family 1 subfamily J member 1
Synonyms: Y71, MOR136-14, GA_x6K02T2NLDC-33507606-33506665, Olfr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18328
HGNC: HGNC:8208
Homologene: 66579
Gscdt
Name: goosecoid homeobox divergent transcript
Synonyms: Gm10000, DIGIT
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 791311
VEGA: 12
Ndufaf3
Name: NADH:ubiquinone oxidoreductase complex assembly factor 3
Synonyms: 4733401H18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66706
Homologene: 32460
4930453N24Rik
Name: RIKEN cDNA 4930453N24 gene
Synonyms: din
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67609
Homologene: 27867
Armcx5
Name: armadillo repeat containing, X-linked 5
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 494468
Homologene: 128366
Acat1
Name: acetyl-Coenzyme A acetyltransferase 1
Synonyms: Acat, 6330585C21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110446
HGNC: HGNC:93
Homologene: 6
Gml
Name: glycosylphosphatidylinositol anchored molecule like
Synonyms: EG625599
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 625599
HGNC: HGNC:4375
Homologene: 48071
Prl7a2
Name: prolactin family 7, subfamily a, member 2
Synonyms: PLP-F, Prlpf
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19114
Homologene: 49263
Gm572
Name: predicted gene 572
Synonyms: LOC230909, b2b1167Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230909
Homologene: 52134
Arv1
Name: ARV1 homolog, fatty acid homeostasis modulator
Synonyms: 1110067L22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68865
Homologene: 41498
Kcnk12
Name: potassium channel, subfamily K, member 12
Synonyms: mntk1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210741
VEGA: 17
HGNC: HGNC:6274
Homologene: 11107
D830039M14Rik
Name: RIKEN cDNA D830039M14 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320949
VEGA: 10
Lelp1
Name: late cornified envelope-like proline-rich 1
Synonyms: 1700012F11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69332
Vmn2r40
Name: vomeronasal 2, receptor 40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042781
Homologene: 113703
1700024P16Rik
Name:
Type: Gene
Species: Mouse
Chromosome: 4
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 80,536,937 bp
  • C to T, chromosome 1 at 131,129,375 bp
  • C to A, chromosome 1 at 171,358,861 bp
  • A to T, chromosome 1 at 174,247,387 bp
  • T to C, chromosome 2 at 36,813,026 bp
  • C to A, chromosome 2 at 76,727,167 bp
  • T to C, chromosome 2 at 85,850,189 bp
  • A to T, chromosome 2 at 87,711,032 bp
  • T to A, chromosome 2 at 164,950,359 bp
  • A to T, chromosome 3 at 92,135,620 bp
  • T to C, chromosome 3 at 92,825,300 bp
  • T to C, chromosome 3 at 127,615,229 bp
  • T to C, chromosome 4 at 3,605,840 bp
  • T to A, chromosome 4 at 32,640,429 bp
  • T to A, chromosome 4 at 85,379,410 bp
  • T to A, chromosome 4 at 98,930,899 bp
  • A to C, chromosome 4 at 104,948,831 bp
  • T to A, chromosome 4 at 148,658,093 bp
  • A to G, chromosome 5 at 8,412,115 bp
  • T to C, chromosome 5 at 26,001,150 bp
  • G to A, chromosome 5 at 107,816,865 bp
  • A to T, chromosome 5 at 147,024,517 bp
  • T to A, chromosome 6 at 86,925,079 bp
  • T to A, chromosome 7 at 7,182,815 bp
  • A to G, chromosome 7 at 8,908,149 bp
  • A to G, chromosome 7 at 45,360,194 bp
  • T to C, chromosome 7 at 49,554,261 bp
  • A to G, chromosome 7 at 49,857,438 bp
  • T to C, chromosome 7 at 75,747,804 bp
  • T to C, chromosome 7 at 98,098,334 bp
  • T to C, chromosome 8 at 27,198,558 bp
  • A to G, chromosome 8 at 110,600,383 bp
  • A to G, chromosome 8 at 124,728,372 bp
  • C to T, chromosome 9 at 44,798,819 bp
  • A to T, chromosome 9 at 53,594,424 bp
  • A to G, chromosome 9 at 64,906,875 bp
  • T to C, chromosome 9 at 100,985,832 bp
  • T to C, chromosome 9 at 108,566,921 bp
  • A to T, chromosome 10 at 26,245,570 bp
  • A to G, chromosome 10 at 41,389,058 bp
  • A to T, chromosome 10 at 61,475,583 bp
  • A to G, chromosome 10 at 78,202,919 bp
  • T to C, chromosome 11 at 50,777,131 bp
  • T to A, chromosome 11 at 80,246,676 bp
  • G to A, chromosome 12 at 4,206,482 bp
  • C to T, chromosome 12 at 76,577,078 bp
  • T to C, chromosome 12 at 104,476,177 bp
  • C to T, chromosome 12 at 108,652,973 bp
  • T to C, chromosome 13 at 27,661,011 bp
  • A to G, chromosome 13 at 34,888,183 bp
  • G to A, chromosome 13 at 48,498,377 bp
  • A to T, chromosome 13 at 62,518,481 bp
  • A to G, chromosome 13 at 67,040,912 bp
  • A to T, chromosome 13 at 81,385,914 bp
  • T to C, chromosome 14 at 42,640,718 bp
  • T to C, chromosome 15 at 74,813,692 bp
  • T to C, chromosome 15 at 101,624,170 bp
  • T to A, chromosome 16 at 63,566,598 bp
  • A to G, chromosome 16 at 64,766,332 bp
  • C to T, chromosome 16 at 72,972,132 bp
  • T to C, chromosome 17 at 24,385,401 bp
  • A to T, chromosome 17 at 87,797,285 bp
  • A to G, chromosome 17 at 90,704,169 bp
  • G to A, chromosome 18 at 12,525,853 bp
  • A to T, chromosome 18 at 62,178,682 bp
  • A to G, chromosome 19 at 6,850,281 bp
  • AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA to AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA, chromosome X at 135,745,704 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8298 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067786-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.