Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8330Btlr/Mmmh
Stock Number:
067799-MU
Citation ID:
RRID:MMRRC_067799-MU
Other Names:
R8330 (G1)
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
B4galt1
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms: Ggtb, Ggtb2, B-1,4-GalT1, beta-1,4-GalT1, GalT, beta 1,4-Galactosyltransferase I, b1,4-Galactosyltransferase I
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14595
HGNC: HGNC:924
Homologene: 20378
S1pr3
Name: sphingosine-1-phosphate receptor 3
Synonyms: LPb3, S1P3, Edg3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13610
VEGA: 13
HGNC: HGNC:3167
Homologene: 3829
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Exoc2
Name: exocyst complex component 2
Synonyms: Sec5, 2410030I24Rik, Sec5l1, Gm29675
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66482
Homologene: 10122
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Rab31
Name: RAB31, member RAS oncogene family
Synonyms: 1700093E07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106572
VEGA: 17
HGNC: HGNC:9771
Homologene: 5001
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 155,313,255 bp
  • A to T, chromosome 2 at 26,951,503 bp
  • T to G, chromosome 2 at 52,227,408 bp
  • T to C, chromosome 2 at 69,824,152 bp
  • G to T, chromosome 2 at 84,670,347 bp
  • A to G, chromosome 2 at 111,912,379 bp
  • G to A, chromosome 2 at 164,027,648 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to G, chromosome 4 at 40,812,787 bp
  • A to G, chromosome 5 at 14,675,297 bp
  • A to T, chromosome 5 at 25,304,694 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • T to C, chromosome 6 at 91,478,764 bp
  • T to A, chromosome 6 at 129,733,731 bp
  • T to A, chromosome 7 at 30,751,941 bp
  • T to G, chromosome 7 at 103,947,403 bp
  • A to T, chromosome 7 at 108,868,839 bp
  • C to T, chromosome 7 at 140,296,318 bp
  • T to C, chromosome 9 at 66,061,473 bp
  • T to C, chromosome 9 at 106,474,870 bp
  • T to A, chromosome 10 at 79,171,716 bp
  • A to G, chromosome 11 at 30,843,583 bp
  • A to G, chromosome 11 at 49,095,810 bp
  • A to G, chromosome 11 at 54,345,208 bp
  • A to G, chromosome 11 at 70,135,959 bp
  • T to C, chromosome 11 at 102,008,627 bp
  • T to C, chromosome 11 at 115,394,113 bp
  • A to T, chromosome 12 at 26,456,406 bp
  • A to G, chromosome 12 at 85,329,953 bp
  • A to G, chromosome 13 at 30,877,573 bp
  • G to T, chromosome 13 at 48,597,914 bp
  • G to A, chromosome 13 at 51,419,137 bp
  • GCAGTCACTAAGAAGTGTAATGCAGTCATCAGGAGGTGTGACACAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA to GCAGTCACTAAGAAGTGTGATGCAGTCACCAGGAGGTGTGA, chromosome 13 at 54,525,364 bp
  • C to T, chromosome 13 at 81,445,343 bp
  • T to A, chromosome 14 at 32,659,793 bp
  • T to A, chromosome 14 at 50,847,705 bp
  • T to A, chromosome 15 at 85,932,300 bp
  • T to C, chromosome 17 at 21,026,051 bp
  • C to T, chromosome 17 at 33,244,113 bp
  • T to C, chromosome 17 at 46,712,134 bp
  • A to T, chromosome 17 at 65,696,274 bp
  • A to T, chromosome 18 at 37,663,323 bp
  • T to C, chromosome 19 at 9,009,662 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8330 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067799-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.