Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8444Btlr/Mmmh
Stock Number:
067826-MU
Citation ID:
RRID:MMRRC_067826-MU
Other Names:
R8444 (G1)
Major Collection:

Strain Information

Ighm
Name: immunoglobulin heavy constant mu
Synonyms: Ig mu, Igh6, Igh-M, muH, IgM
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16019
HGNC: HGNC:5541
Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Chst5
Name: carbohydrate sulfotransferase 5
Synonyms: I-GlcNAc6ST, GST-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56773
Homologene: 56927
Rnf111
Name: ring finger 111
Synonyms: Arkadia
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 93836
VEGA: 9
Homologene: 9741
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94088
Homologene: 14381
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Zfp532
Name: zinc finger protein 532
Synonyms: C530030I18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328977
Homologene: 138627
Rbm25
Name: RNA binding motif protein 25
Synonyms: 2610015J01Rik, A130095G20Rik, 2600011C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67039
Dnm1l
Name: dynamin 1-like
Synonyms: 6330417M19Rik, Drp1, python, Dnmlp1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74006
VEGA: 16
HGNC: HGNC:2973
Homologene: 6384
Esrrb
Name: estrogen related receptor, beta
Synonyms: Estrrb, ERRb, ERR2, Err2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26380
HGNC: HGNC:3473
Homologene: 69108
Kif5b
Name: kinesin family member 5B
Synonyms: Khc, kinesin heavy chain
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16573
HGNC: HGNC:6324
Homologene: 55829
Cdkal1
Name: CDK5 regulatory subunit associated protein 1-like 1
Synonyms: 6620401C13Rik, 1190005B03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68916
Homologene: 9830
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Snx8
Name: sorting nexin 8
Synonyms: B130023O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231834
Homologene: 8338
Afdn
Name: afadin, adherens junction formation factor
Synonyms: AF6, Afadin, S-afadin, I-afadin, 5033403D15Rik, Mllt4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Pon1
Name: paraoxonase 1
Synonyms: Pon
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18979
HGNC: HGNC:9204
Homologene: 68058
Immt
Name: inner membrane protein, mitochondrial
Synonyms: P87/89, P89, P87, HMP, 1700082C19Rik, D830041H16Rik, mitofilin, Micos60
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76614
HGNC: HGNC:6047
Homologene: 38234
Brms1
Name: breast cancer metastasis-suppressor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107392
VEGA: 19
Homologene: 32260
Mtg1
Name: mitochondrial ribosome-associated GTPase 1
Synonyms: LOC212508, Gtpbp7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212508
Homologene: 44527
Aldh16a1
Name: aldehyde dehydrogenase 16 family, member A1
Synonyms: 2410004H02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69748
Homologene: 34938
Atoh1
Name: atonal bHLH transcription factor 1
Synonyms: Math1, Hath1, bHLHa14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11921
HGNC: HGNC:797
Homologene: 31297
Aip
Name: aryl-hydrocarbon receptor-interacting protein
Synonyms: Ara9, Xap2, D19Bwg1412e, Fkbp16
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11632
HGNC: HGNC:358
Homologene: 2959
Cpt1a
Name: carnitine palmitoyltransferase 1a, liver
Synonyms: CPTI, L-CPT I, Cpt1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12894
VEGA: 19
HGNC: HGNC:2328
Homologene: 1413
Gja8
Name: gap junction protein, alpha 8
Synonyms: Cnx50, connexin 50, alpha 8 connexin, Cx50, Aey5, Lop10, dcm
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14616
HGNC: HGNC:4281
Homologene: 3857
Casc3
Name: exon junction complex subunit
Synonyms: Btz, Mln51
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192160
Homologene: 7208
Shoc2
Name: Shoc2, leucine rich repeat scaffold protein
Synonyms: Sur-8, soc-2 (suppressor of clear) homolog (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56392
VEGA: 19
Homologene: 7219
Ifnar2
Name: interferon (alpha and beta) receptor 2
Synonyms: Ifnar-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15976
HGNC: HGNC:5433
Homologene: 49242
Stk40
Name: serine/threonine kinase 40
Synonyms: 2310004N11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74178
Homologene: 12542
Ice1
Name: interactor of little elongation complex ELL subunit 1
Synonyms: BC018507
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218333
VEGA: 13
Homologene: 18902
Atp2b2
Name: ATPase, Ca++ transporting, plasma membrane 2
Synonyms: PMCA2, D6Abb2e, wms, jog, Tmy, Gena300
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11941
HGNC: HGNC:815
Homologene: 56150
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Hps6
Name: HPS6, biogenesis of lysosomal organelles complex 2 subunit 3
Synonyms: 5330434M19Rik, ruby eye, ru, BLOC-2, Hermansky-Pudlak syndrome 6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20170
VEGA: 19
Homologene: 11691
Abca3
Name: ATP-binding cassette, sub-family A member 3
Synonyms: ABC-C, Abc3, 1810036E22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27410
HGNC: HGNC:33
Homologene: 37437
Cpne5
Name: copine V
Synonyms: A830083G22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240058
HGNC: HGNC:2318
Homologene: 23266
Slc35d1
Name: solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1
Synonyms: UGTREL7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242585
Homologene: 22870
Mx1
Name: MX dynamin-like GTPase 1
Synonyms: myxovirus (influenza) resistance 1 polypeptide, Mx-1, Mx
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17857
Ephb2
Name: Eph receptor B2
Synonyms: eteck, Erk, Tyro5, Prkm5, Nuk, Drt, Hek5, Sek3, Qek5, Cek5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13844
HGNC: HGNC:3393
Homologene: 37925
Srgap3
Name: SLIT-ROBO Rho GTPase activating protein 3
Synonyms: Arhgap14, D130026O08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 259302
Homologene: 56686
Col5a2
Name: collagen, type V, alpha 2
Synonyms: 1110014L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12832
HGNC: HGNC:2210
Homologene: 20119
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Odad4
Name: outer dynein arm complex subunit 4
Synonyms: 4933404O19Rik, Ttc25
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74407
Homologene: 12860
Slc8b1
Name: solute carrier family 8 (sodium/lithium/calcium exchanger), member B1
Synonyms: NCKX6, NCLX, Slc24a6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170756
Homologene: 41602
Irs2
Name: insulin receptor substrate 2
Synonyms: Irs-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384783
HGNC: HGNC:6126
Homologene: 2778
Vmn2r72
Name: vomeronasal 2, receptor 72
Synonyms: EG244114, Vmn2r72-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244114
Homologene: 115466
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Flg2
Name: filaggrin family member 2
Synonyms: EG229574
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229574
Homologene: 134146
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 116904
Homologene: 10813
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Tmem177
Name: transmembrane protein 177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66343
Homologene: 12732
Kcnk4
Name: potassium channel, subfamily K, member 4
Synonyms: TRAAKt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16528
VEGA: 19
HGNC: HGNC:6279
Homologene: 7391
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Or5p79
Name: olfactory receptor family 5 subfamily P member 79
Synonyms: GA_x6K02T2PBJ9-10951546-10952496, MOR204-7, Olfr507
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258738
Homologene: 27249
Slc23a1
Name: solute carrier family 23 (nucleobase transporters), member 1
Synonyms: YSPL3, SVCT1, D18Ucla2, Slc23a2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20522
Homologene: 40769
Zbtb8b
Name: zinc finger and BTB domain containing 8b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 215627
Homologene: 65127
Or10ag59
Name: olfactory receptor family 10 subfamily AG member 59
Synonyms: GA_x6K02T2Q125-49078087-49079031, MOR264-23, MOR264-9P, Olfr1129
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258111
Homologene: 133705
Smr3a
Name: submaxillary gland androgen regulated protein 3A
Synonyms: MSG3, MSG1, Smr3, Smr1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20599
Dsc1
Name: desmocollin 1
Synonyms: Dsc1b, Dsc1a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13505
VEGA: 18
HGNC: HGNC:3035
Homologene: 22761
Aoc3
Name: amine oxidase, copper containing 3
Synonyms: SSAO, semicarbazide-sensitive amine oxidase, VAP1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11754
HGNC: HGNC:550
Homologene: 2770
Abcd2
Name: ATP-binding cassette, sub-family D member 2
Synonyms: ALDR, ALDL1, adrenoleukodystrophy related, ABC39
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 26874
VEGA: 15
HGNC: HGNC:66
Homologene: 55873
Vmn2r67
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620672
Homologene: 115466
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Slc17a2
Name: solute carrier family 17 (sodium phosphate), member 2
Synonyms: NPT3, C730032N17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218103
Homologene: 4260
Or5p6
Name: olfactory receptor family 5 subfamily P member 6
Synonyms: GA_x6K02T2PBJ9-10361879-10360935, MOR204-13, Olfr478
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258729
Homologene: 128076
Pde6d
Name: phosphodiesterase 6D, cGMP-specific, rod, delta
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18582
HGNC: HGNC:8788
Homologene: 1954
Or6c65
Name: olfactory receptor family 6 subfamily C member 65
Synonyms: GA_x6K02T2PULF-11446184-11447122, MOR112-2, Olfr808
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258930
Homologene: 17438
Or56a41
Name: olfactory receptor family 56 subfamily A member 41, pseudogene 1
Synonyms: GA_x6K02T2PBJ9-7720330-7719479, MOR40-10P, Olfr680
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257981
Cfap276
Name: cilia and flagella associated protein 276
Synonyms: 1700013F07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75504
Homologene: 18986
Tysnd1
Name: trypsin domain containing 1
Synonyms: 1300019N10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71767
VEGA: 10
Homologene: 87946
Bacc1
Name: BPTF associated chromatin complex component 1
Synonyms: 0610010K14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104457
Homologene: 12273
Wdr49
Name: WD repeat domain 49
Synonyms: EG213248
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213248
Homologene: 18714
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 45,396,145 bp
  • A to G, chromosome 1 at 86,543,528 bp
  • T to A, chromosome 1 at 104,970,858 bp
  • A to T, chromosome 1 at 119,910,220 bp
  • T to A, chromosome 1 at 194,958,500 bp
  • T to C, chromosome 2 at 40,870,260 bp
  • G to A, chromosome 2 at 87,575,739 bp
  • A to C, chromosome 3 at 75,451,690 bp
  • A to T, chromosome 3 at 90,273,952 bp
  • A to T, chromosome 3 at 93,200,278 bp
  • A to G, chromosome 3 at 96,919,674 bp
  • A to G, chromosome 3 at 108,544,068 bp
  • G to C, chromosome 4 at 103,214,699 bp
  • A to G, chromosome 4 at 126,118,334 bp
  • A to G, chromosome 4 at 129,432,631 bp
  • C to T, chromosome 4 at 136,661,400 bp
  • A to C, chromosome 5 at 88,004,752 bp
  • C to T, chromosome 5 at 120,513,138 bp
  • G to A, chromosome 5 at 140,358,174 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • C to T, chromosome 6 at 5,177,327 bp
  • T to C, chromosome 6 at 64,729,657 bp
  • C to T, chromosome 6 at 71,871,508 bp
  • A to G, chromosome 6 at 112,775,548 bp
  • T to A, chromosome 6 at 113,793,811 bp
  • G to A, chromosome 7 at 45,149,691 bp
  • A to G, chromosome 7 at 55,872,154 bp
  • G to A, chromosome 7 at 75,730,465 bp
  • A to C, chromosome 7 at 81,057,720 bp
  • A to T, chromosome 7 at 85,136,646 bp
  • A to G, chromosome 7 at 85,738,175 bp
  • G to A, chromosome 7 at 104,232,672 bp
  • A to G, chromosome 7 at 105,090,958 bp
  • C to A, chromosome 7 at 108,031,863 bp
  • A to G, chromosome 7 at 108,621,820 bp
  • T to A, chromosome 7 at 120,318,910 bp
  • T to C, chromosome 7 at 140,138,370 bp
  • A to G, chromosome 8 at 11,006,683 bp
  • T to C, chromosome 8 at 111,890,763 bp
  • A to T, chromosome 9 at 70,457,941 bp
  • A to G, chromosome 10 at 61,696,171 bp
  • T to A, chromosome 10 at 107,857,114 bp
  • T to A, chromosome 10 at 129,767,925 bp
  • G to T, chromosome 11 at 70,236,929 bp
  • C to T, chromosome 11 at 98,822,781 bp
  • G to T, chromosome 11 at 100,561,905 bp
  • G to T, chromosome 11 at 101,341,747 bp
  • A to G, chromosome 12 at 81,722,196 bp
  • T to A, chromosome 12 at 83,664,251 bp
  • G to A, chromosome 12 at 86,505,821 bp
  • A to C, chromosome 12 at 113,421,193 bp
  • A to T, chromosome 13 at 23,819,078 bp
  • A to T, chromosome 13 at 29,326,104 bp
  • T to C, chromosome 13 at 70,604,376 bp
  • T to A, chromosome 14 at 96,517,890 bp
  • A to G, chromosome 15 at 73,570,823 bp
  • A to G, chromosome 15 at 91,174,636 bp
  • T to C, chromosome 16 at 4,288,623 bp
  • C to T, chromosome 16 at 16,341,042 bp
  • C to A, chromosome 16 at 91,403,969 bp
  • G to T, chromosome 16 at 97,451,487 bp
  • A to T, chromosome 17 at 13,883,800 bp
  • A to G, chromosome 17 at 24,383,985 bp
  • A to T, chromosome 17 at 29,188,383 bp
  • T to A, chromosome 18 at 6,213,245 bp
  • T to A, chromosome 18 at 20,089,579 bp
  • T to A, chromosome 18 at 35,624,436 bp
  • C to A, chromosome 18 at 65,624,259 bp
  • T to C, chromosome 19 at 3,381,981 bp
  • T to A, chromosome 19 at 4,116,034 bp
  • T to C, chromosome 19 at 5,041,492 bp
  • T to C, chromosome 19 at 6,926,140 bp
  • T to G, chromosome 19 at 46,005,428 bp
  • A to G, chromosome 19 at 53,988,072 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8444 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067826-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.