Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8444Btlr/Mmmh
Stock Number:
067826-MU
Citation ID:
RRID:MMRRC_067826-MU
Other Names:
R8444 (G1)
Major Collection:

Strain Information

Ighm
Name: immunoglobulin heavy constant mu
Synonyms: Ig mu, Igh6, Igh-M, muH, IgM, TC1460681
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16019
HGNC: HGNC:5541
Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Chst5
Name: carbohydrate sulfotransferase 5
Synonyms: I-GlcNAc6ST, GST-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56773
Homologene: 56927
Rnf111
Name: ring finger protein 111
Synonyms: Arkadia
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 93836
VEGA: 9
Homologene: 9741
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94088
Homologene: 14381
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Zfp532
Name: zinc finger protein 532
Synonyms: C530030I18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328977
Homologene: 138627
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 45,396,145 bp
  • A to G, chromosome 1 at 86,543,528 bp
  • T to A, chromosome 1 at 104,970,858 bp
  • A to T, chromosome 1 at 119,910,220 bp
  • T to A, chromosome 1 at 194,958,500 bp
  • T to C, chromosome 2 at 40,870,260 bp
  • G to A, chromosome 2 at 87,575,739 bp
  • A to C, chromosome 3 at 75,451,690 bp
  • A to T, chromosome 3 at 90,273,952 bp
  • A to T, chromosome 3 at 93,200,278 bp
  • A to G, chromosome 3 at 96,919,674 bp
  • A to G, chromosome 3 at 108,544,068 bp
  • G to C, chromosome 4 at 103,214,699 bp
  • A to G, chromosome 4 at 126,118,334 bp
  • A to G, chromosome 4 at 129,432,631 bp
  • C to T, chromosome 4 at 136,661,400 bp
  • A to C, chromosome 5 at 88,004,752 bp
  • C to T, chromosome 5 at 120,513,138 bp
  • G to A, chromosome 5 at 140,358,174 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • C to T, chromosome 6 at 5,177,327 bp
  • T to C, chromosome 6 at 64,729,657 bp
  • C to T, chromosome 6 at 71,871,508 bp
  • A to G, chromosome 6 at 112,775,548 bp
  • T to A, chromosome 6 at 113,793,811 bp
  • G to A, chromosome 7 at 45,149,691 bp
  • A to G, chromosome 7 at 55,872,154 bp
  • G to A, chromosome 7 at 75,730,465 bp
  • A to C, chromosome 7 at 81,057,720 bp
  • A to T, chromosome 7 at 85,136,646 bp
  • A to G, chromosome 7 at 85,738,175 bp
  • G to A, chromosome 7 at 104,232,672 bp
  • A to G, chromosome 7 at 105,090,958 bp
  • C to A, chromosome 7 at 108,031,863 bp
  • A to G, chromosome 7 at 108,621,820 bp
  • T to A, chromosome 7 at 120,318,910 bp
  • T to C, chromosome 7 at 140,138,370 bp
  • A to G, chromosome 8 at 11,006,683 bp
  • T to C, chromosome 8 at 111,890,763 bp
  • A to T, chromosome 9 at 70,457,941 bp
  • A to G, chromosome 10 at 61,696,171 bp
  • T to A, chromosome 10 at 107,857,114 bp
  • T to A, chromosome 10 at 129,767,925 bp
  • G to T, chromosome 11 at 70,236,929 bp
  • C to T, chromosome 11 at 98,822,781 bp
  • G to T, chromosome 11 at 100,561,905 bp
  • G to T, chromosome 11 at 101,341,747 bp
  • A to G, chromosome 12 at 81,722,196 bp
  • T to A, chromosome 12 at 83,664,251 bp
  • G to A, chromosome 12 at 86,505,821 bp
  • A to C, chromosome 12 at 113,421,193 bp
  • A to T, chromosome 13 at 23,819,078 bp
  • A to T, chromosome 13 at 29,326,104 bp
  • T to C, chromosome 13 at 70,604,376 bp
  • T to A, chromosome 14 at 96,517,890 bp
  • A to G, chromosome 15 at 73,570,823 bp
  • A to G, chromosome 15 at 91,174,636 bp
  • T to C, chromosome 16 at 4,288,623 bp
  • C to T, chromosome 16 at 16,341,042 bp
  • C to A, chromosome 16 at 91,403,969 bp
  • G to T, chromosome 16 at 97,451,487 bp
  • A to T, chromosome 17 at 13,883,800 bp
  • A to G, chromosome 17 at 24,383,985 bp
  • A to T, chromosome 17 at 29,188,383 bp
  • T to A, chromosome 18 at 6,213,245 bp
  • T to A, chromosome 18 at 20,089,579 bp
  • T to A, chromosome 18 at 35,624,436 bp
  • C to A, chromosome 18 at 65,624,259 bp
  • T to C, chromosome 19 at 3,381,981 bp
  • T to A, chromosome 19 at 4,116,034 bp
  • T to C, chromosome 19 at 5,041,492 bp
  • T to C, chromosome 19 at 6,926,140 bp
  • T to G, chromosome 19 at 46,005,428 bp
  • A to G, chromosome 19 at 53,988,072 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8444 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067826-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.