Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8334Btlr/Mmmh
Stock Number:
067862-MU
Citation ID:
RRID:MMRRC_067862-MU
Other Names:
R8334 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100763
Homologene: 8783
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: 5033413A03Rik, SRm300
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 75,217,301 bp
  • T to A, chromosome 1 at 146,902,053 bp
  • C to T, chromosome 1 at 160,118,483 bp
  • G to A, chromosome 1 at 182,611,105 bp
  • T to C, chromosome 2 at 20,781,046 bp
  • T to A, chromosome 2 at 32,280,451 bp
  • C to T, chromosome 2 at 76,808,030 bp
  • T to C, chromosome 2 at 90,400,933 bp
  • T to C, chromosome 2 at 120,137,064 bp
  • T to C, chromosome 2 at 150,858,453 bp
  • C to T, chromosome 2 at 153,054,963 bp
  • C to T, chromosome 3 at 87,927,749 bp
  • A to T, chromosome 3 at 103,353,829 bp
  • G to T, chromosome 3 at 115,122,557 bp
  • A to G, chromosome 4 at 28,938,777 bp
  • C to T, chromosome 4 at 63,494,810 bp
  • C to A, chromosome 4 at 106,638,918 bp
  • T to C, chromosome 4 at 123,432,108 bp
  • T to A, chromosome 4 at 134,931,275 bp
  • T to A, chromosome 4 at 154,282,767 bp
  • T to A, chromosome 5 at 29,590,884 bp
  • C to T, chromosome 5 at 29,781,240 bp
  • T to G, chromosome 5 at 94,682,776 bp
  • T to C, chromosome 5 at 97,027,894 bp
  • T to A, chromosome 5 at 113,075,979 bp
  • A to T, chromosome 6 at 17,934,221 bp
  • A to C, chromosome 6 at 41,539,112 bp
  • T to C, chromosome 6 at 92,937,244 bp
  • A to C, chromosome 7 at 5,484,060 bp
  • A to G, chromosome 7 at 28,831,823 bp
  • C to T, chromosome 7 at 44,904,711 bp
  • A to G, chromosome 7 at 64,872,719 bp
  • G to T, chromosome 7 at 135,696,516 bp
  • A to G, chromosome 7 at 141,168,631 bp
  • A to G, chromosome 8 at 25,802,019 bp
  • A to G, chromosome 9 at 22,444,118 bp
  • T to A, chromosome 9 at 38,994,593 bp
  • A to G, chromosome 9 at 53,522,273 bp
  • CGGGG to CGGGGG, chromosome 9 at 108,841,272 bp
  • A to G, chromosome 10 at 41,923,765 bp
  • T to C, chromosome 10 at 53,108,148 bp
  • T to C, chromosome 11 at 16,983,220 bp
  • C to A, chromosome 11 at 22,007,170 bp
  • G to A, chromosome 11 at 49,058,894 bp
  • A to T, chromosome 11 at 62,383,244 bp
  • A to G, chromosome 11 at 69,350,796 bp
  • G to A, chromosome 11 at 72,317,644 bp
  • A to G, chromosome 11 at 85,576,811 bp
  • A to T, chromosome 11 at 110,068,824 bp
  • T to C, chromosome 12 at 102,758,138 bp
  • G to A, chromosome 12 at 111,093,095 bp
  • C to T, chromosome 13 at 18,125,406 bp
  • A to T, chromosome 13 at 49,050,482 bp
  • A to G, chromosome 13 at 78,025,273 bp
  • T to C, chromosome 14 at 65,645,029 bp
  • G to A, chromosome 15 at 76,446,556 bp
  • A to T, chromosome 15 at 76,603,587 bp
  • T to C, chromosome 15 at 76,716,000 bp
  • T to C, chromosome 16 at 57,570,147 bp
  • T to C, chromosome 17 at 23,808,356 bp
  • T to A, chromosome 17 at 25,171,607 bp
  • T to A, chromosome 17 at 30,769,831 bp
  • C to T, chromosome 17 at 35,909,258 bp
  • A to G, chromosome 17 at 39,073,904 bp
  • T to A, chromosome 17 at 46,166,442 bp
  • A to G, chromosome 18 at 32,859,293 bp
  • A to G, chromosome 18 at 37,444,800 bp
  • T to C, chromosome 18 at 60,270,982 bp
  • G to T, chromosome 19 at 3,814,795 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8334 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067862-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.