Strain Name:
C57BL/6J-MtgxR8334Btlr/Mmmh
Stock Number:
067862-MU
Citation ID:
RRID:MMRRC_067862-MU
Other Names:
R8334 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Mdk1, Hek11, Ehk3, Cek11, Ebk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, Acf7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100763
Homologene: 8783
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, Skt, E330027G05Rik, 9430077C05Rik, Sickle tail, 6620402G01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: SRm300, 5033413A03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Ubr7
Name: ubiquitin protein ligase E3 component n-recognin 7 (putative)
Synonyms: 5730410I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66622
VEGA: 12
Homologene: 11998
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, Ki67, D630048A14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Bcas3
Name: BCAS3 microtubule associated cell migration factor
Synonyms: rudhira, breast carcinoma amplified sequence 3, Phaf2, 1500019F07Rik, 2610028P08Rik, K20D4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192197
Homologene: 9778
Ehd4
Name: EH-domain containing 4
Synonyms: 2210022F10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98878
HGNC: HGNC:3245
Homologene: 26430
Swi5
Name: SWI5 recombination repair homolog (yeast)
Synonyms: 1500019F05Rik, 2900010J23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72931
Homologene: 128744
St7
Name: suppression of tumorigenicity 7
Synonyms: Fam4a2, 9430001H04Rik, HELG, SEN4, RAY1, TSG7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64213
Homologene: 10185
Rcor1
Name: REST corepressor 1
Synonyms: D12Wsu95e, 6720480E22Rik, Rocr1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217864
Homologene: 32246
Olfm3
Name: olfactomedin 3
Synonyms: optimedin, B230206G02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229759
Homologene: 17103
Ap2a1
Name: adaptor-related protein complex 2, alpha 1 subunit
Synonyms: Adtaa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11771
HGNC: HGNC:561
Homologene: 68997
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, Dnahc8, P1-Loop
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Dnajb6
Name: DnaJ heat shock protein family (Hsp40) member B6
Synonyms: Mrj, mDj4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23950
Homologene: 38058
Lsm1
Name: LSM1 homolog, mRNA degradation associated
Synonyms: U6 small nuclear RNA associated, 2810025O06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67207
Homologene: 40945
Wdr36
Name: WD repeat domain 36
Synonyms: 5730444A13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225348
VEGA: 18
Homologene: 6536
Trim33
Name: tripartite motif-containing 33
Synonyms: ectodermin, Ecto, 8030451N04Rik, Tif1g
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94093
Homologene: 9296
Ehbp1
Name: EH domain binding protein 1
Synonyms: KIAA0903-like, Flj21950
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216565
Homologene: 22880
Ttn
Name: titin
Synonyms: connectin, shru, D330041I19Rik, 2310057K23Rik, mdm, D830007G01Rik, 2310074I15Rik, 1100001C23Rik, 2310036G12Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Kmt5b
Name: lysine methyltransferase 5B
Synonyms: Suv420h1, C630029K18Rik, Suv4-20h1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225888
Homologene: 32351
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Chd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Brinp3
Name: bone morphogenetic protein/retinoic acid inducible neural specific 3
Synonyms: Fam5c, B830045N13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215378
Homologene: 17786
Tnn
Name: tenascin N
Synonyms: Tnw, tenascin-W
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329278
Homologene: 18634
Plek
Name: pleckstrin
Synonyms: 2010300B13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56193
HGNC: HGNC:9070
Homologene: 2000
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: ESTM15, 1810073P09Rik, X83337
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75607
Homologene: 19155
Ttc22
Name: tetratricopeptide repeat domain 22
Synonyms: 4732467L16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230576
Homologene: 89253
Pcdhb13
Name: protocadherin beta 13
Synonyms: PcdhbM, Pcdbh6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Adamts9
Name: ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms: Mhdaund3, Mhdaund4, 1810011L16Rik, UND4, E030027K14Rik, 8430403M15Rik, Gsfund3, UND3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101401
Homologene: 18821
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Capn8
Name: calpain 8
Synonyms: nCL-2, nCL-2'
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170725
HGNC: HGNC:1485
Homologene: 15643
Rnh1
Name: ribonuclease/angiogenin inhibitor 1
Synonyms: RNH
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 107702
Homologene: 2204
Mroh1
Name: maestro heat-like repeat family member 1
Synonyms: D330001F17Rik, Heatr7a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223658
Homologene: 44882
Whrn
Name: whirlin
Synonyms: wi, C430046P22Rik, Dfnb31, 1110035G07Rik, Ush2d
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73750
Homologene: 18739
Nuggc
Name: nuclear GTPase, germinal center associated
Synonyms: SLIP-GC, LOC239151, Gm600
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100503545
Homologene: 72641
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Xkr7
Name: X-linked Kx blood group related 7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228787
Homologene: 19390
Crybb3
Name: crystallin, beta B3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12962
HGNC: HGNC:2400
Homologene: 3008
Armc2
Name: armadillo repeat containing 2
Synonyms: 2610018I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213402
Homologene: 41848
Or8g21
Name: olfactory receptor family 8 subfamily G member 21
Synonyms: MOR171-11, Olfr935, GA_x6K02T2PVTD-32691280-32690354
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258741
VEGA: 9
Homologene: 133683
Ccdc154
Name: coiled-coil domain containing 154
Synonyms: ntl, LOC207209
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 207209
Homologene: 19361
Bmp2k
Name: BMP2 inducible kinase
Synonyms: 4933417M22Rik, BIKE
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140780
Homologene: 34134
Gm4841
Name: predicted gene 4841
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225594
VEGA: 18
Fbxo39
Name: F-box protein 39
Synonyms: 1700010H23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 628100
Homologene: 15156
Vmn2r28
Name: vomeronasal 2, receptor 28
Synonyms: EG665255
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665255
Homologene: 129605
Pou6f2
Name: POU domain, class 6, transcription factor 2
Synonyms: RPF-1, D130006K24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218030
Lrrc24
Name: leucine rich repeat containing 24
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 378937
Homologene: 86785
Abhd12
Name: abhydrolase domain containing 12
Synonyms: 1500011G07Rik, 6330583M11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76192
Homologene: 22910
Tuba4a
Name: tubulin, alpha 4A
Synonyms: M[a]4, Tuba4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22145
Homologene: 68496
Arhgef16
Name: Rho guanine nucleotide exchange factor 16
Synonyms: Neuroblastoma
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230972
Homologene: 82484
Pou5f2
Name: POU domain class 5, transcription factor 2
Synonyms: 1700013G10Rik, Sprm1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75507
Homologene: 83454
Atat1
Name: alpha tubulin acetyltransferase 1
Synonyms: MEC-17, 2610110G12Rik, 0610011P08Rik, 2610008K08Rik, 3110080J08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73242
Homologene: 15129
Syf2
Name: SYF2 homolog, RNA splicing factor (S. cerevisiae)
Synonyms: Ntc31, mp29, 1110018L13Rik, p29, Gcipip, D4Bwg1551e, Cbpin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68592
Homologene: 5993
Slc35f1
Name: solute carrier family 35, member F1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215085
Homologene: 33552
Gtpbp2
Name: GTP binding protein 2
Synonyms: nmf205
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56055
HGNC: HGNC:4670
Homologene: 10420
Filip1l
Name: filamin A interacting protein 1-like
Synonyms: 4631422O05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78749
Homologene: 37121
Matcap2
Name: microtubule associated tyrosine carboxypeptidase 2
Synonyms: 9530077C05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68283
VEGA: 9
Homologene: 19280
Nsmce3
Name: NSE3 homolog, SMC5-SMC6 complex component
Synonyms: Ndnl2, HCA4, 5730494G16Rik, Mageg1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66647
HGNC: HGNC:7677
Homologene: 41520
Tgtp2
Name: T cell specific GTPase 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100039796
Homologene: 129991
Ech1
Name: enoyl coenzyme A hydratase 1, peroxisomal
Synonyms: dienoyl-CoA isomerase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 51798
HGNC: HGNC:3149
Homologene: 1069
Mettl25b
Name: methyltransferase like 25B
Synonyms: Rrnad1, BC023814
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229503
Homologene: 9332
Or4x13
Name: olfactory receptor family 4 subfamily X member 13
Synonyms: Olfr1274-ps, GA_x6K02T2Q125-51676372-51677301, MOR228-5, MOR228-4, Olfr1274
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258330
Homologene: 133650
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Mpk4, Pyst3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Trbc1
Name: T cell receptor beta, constant region 1
Synonyms: Gm16802, Tcrb-C1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100125262
Esp23
Name: exocrine gland secreted peptide 23
Synonyms: Gm20581
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100126779
VEGA: 17
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 75,217,301 bp
  • T to A, chromosome 1 at 146,902,053 bp
  • C to T, chromosome 1 at 160,118,483 bp
  • G to A, chromosome 1 at 182,611,105 bp
  • T to C, chromosome 2 at 20,781,046 bp
  • T to A, chromosome 2 at 32,280,451 bp
  • C to T, chromosome 2 at 76,808,030 bp
  • T to C, chromosome 2 at 90,400,933 bp
  • T to C, chromosome 2 at 120,137,064 bp
  • T to C, chromosome 2 at 150,858,453 bp
  • C to T, chromosome 2 at 153,054,963 bp
  • C to T, chromosome 3 at 87,927,749 bp
  • A to T, chromosome 3 at 103,353,829 bp
  • G to T, chromosome 3 at 115,122,557 bp
  • A to G, chromosome 4 at 28,938,777 bp
  • C to T, chromosome 4 at 63,494,810 bp
  • C to A, chromosome 4 at 106,638,918 bp
  • T to C, chromosome 4 at 123,432,108 bp
  • T to A, chromosome 4 at 134,931,275 bp
  • T to A, chromosome 4 at 154,282,767 bp
  • T to A, chromosome 5 at 29,590,884 bp
  • C to T, chromosome 5 at 29,781,240 bp
  • T to G, chromosome 5 at 94,682,776 bp
  • T to C, chromosome 5 at 97,027,894 bp
  • T to A, chromosome 5 at 113,075,979 bp
  • A to T, chromosome 6 at 17,934,221 bp
  • A to C, chromosome 6 at 41,539,112 bp
  • T to C, chromosome 6 at 92,937,244 bp
  • A to C, chromosome 7 at 5,484,060 bp
  • A to G, chromosome 7 at 28,831,823 bp
  • C to T, chromosome 7 at 44,904,711 bp
  • A to G, chromosome 7 at 64,872,719 bp
  • G to T, chromosome 7 at 135,696,516 bp
  • A to G, chromosome 7 at 141,168,631 bp
  • A to G, chromosome 8 at 25,802,019 bp
  • A to G, chromosome 9 at 22,444,118 bp
  • T to A, chromosome 9 at 38,994,593 bp
  • A to G, chromosome 9 at 53,522,273 bp
  • CGGGG to CGGGGG, chromosome 9 at 108,841,272 bp
  • A to G, chromosome 10 at 41,923,765 bp
  • T to C, chromosome 10 at 53,108,148 bp
  • T to C, chromosome 11 at 16,983,220 bp
  • C to A, chromosome 11 at 22,007,170 bp
  • G to A, chromosome 11 at 49,058,894 bp
  • A to T, chromosome 11 at 62,383,244 bp
  • A to G, chromosome 11 at 69,350,796 bp
  • G to A, chromosome 11 at 72,317,644 bp
  • A to G, chromosome 11 at 85,576,811 bp
  • A to T, chromosome 11 at 110,068,824 bp
  • T to C, chromosome 12 at 102,758,138 bp
  • G to A, chromosome 12 at 111,093,095 bp
  • C to T, chromosome 13 at 18,125,406 bp
  • A to T, chromosome 13 at 49,050,482 bp
  • A to G, chromosome 13 at 78,025,273 bp
  • T to C, chromosome 14 at 65,645,029 bp
  • G to A, chromosome 15 at 76,446,556 bp
  • A to T, chromosome 15 at 76,603,587 bp
  • T to C, chromosome 15 at 76,716,000 bp
  • T to C, chromosome 16 at 57,570,147 bp
  • T to C, chromosome 17 at 23,808,356 bp
  • T to A, chromosome 17 at 25,171,607 bp
  • T to A, chromosome 17 at 30,769,831 bp
  • C to T, chromosome 17 at 35,909,258 bp
  • A to G, chromosome 17 at 39,073,904 bp
  • T to A, chromosome 17 at 46,166,442 bp
  • A to G, chromosome 18 at 32,859,293 bp
  • A to G, chromosome 18 at 37,444,800 bp
  • T to C, chromosome 18 at 60,270,982 bp
  • G to T, chromosome 19 at 3,814,795 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8334 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067862-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.