Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8343Btlr/Mmmh
Stock Number:
067866-MU
Citation ID:
RRID:MMRRC_067866-MU
Other Names:
R8343 (G1)
Major Collection:

Strain Information

Stx8
Name: syntaxin 8
Synonyms: 1110002H11Rik, 0610007H08Rik, 4930571E13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 55943
Homologene: 37973
Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: 5730502P04Rik, CAP-E, Fin16, Smc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14211
Homologene: 4705
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: 6430573H23Rik, Prkwnk1, EG406236, Hsn2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232341
Homologene: 14253
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 136,627,882 bp
  • T to A, chromosome 1 at 163,996,940 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • C to T, chromosome 2 at 52,308,271 bp
  • T to A, chromosome 2 at 58,474,274 bp
  • A to T, chromosome 2 at 59,901,514 bp
  • T to C, chromosome 2 at 62,850,535 bp
  • G to T, chromosome 2 at 73,199,401 bp
  • T to C, chromosome 2 at 140,230,833 bp
  • T to C, chromosome 2 at 170,120,104 bp
  • T to G, chromosome 3 at 10,194,025 bp
  • T to C, chromosome 3 at 102,768,910 bp
  • C to T, chromosome 3 at 148,846,906 bp
  • T to A, chromosome 4 at 52,450,965 bp
  • T to A, chromosome 4 at 92,146,344 bp
  • T to A, chromosome 4 at 126,376,928 bp
  • C to A, chromosome 4 at 130,945,989 bp
  • T to A, chromosome 5 at 34,905,724 bp
  • T to A, chromosome 5 at 86,533,807 bp
  • C to T, chromosome 5 at 112,450,787 bp
  • G to C, chromosome 5 at 136,697,971 bp
  • T to A, chromosome 5 at 143,225,807 bp
  • T to C, chromosome 5 at 149,287,609 bp
  • G to A, chromosome 6 at 91,726,243 bp
  • C to T, chromosome 6 at 119,963,493 bp
  • A to G, chromosome 6 at 125,163,263 bp
  • T to C, chromosome 6 at 134,248,754 bp
  • G to T, chromosome 7 at 27,523,608 bp
  • A to G, chromosome 7 at 45,176,595 bp
  • ATGGCG to ATGGCGACGGTGGCG, chromosome 7 at 97,579,904 bp
  • A to T, chromosome 7 at 104,068,176 bp
  • C to T, chromosome 7 at 119,442,787 bp
  • A to G, chromosome 7 at 141,491,805 bp
  • G to A, chromosome 7 at 141,864,161 bp
  • A to G, chromosome 8 at 34,834,584 bp
  • T to A, chromosome 8 at 84,130,773 bp
  • T to A, chromosome 8 at 105,691,084 bp
  • T to C, chromosome 8 at 105,996,013 bp
  • T to A, chromosome 8 at 111,040,729 bp
  • T to C, chromosome 9 at 100,757,766 bp
  • T to C, chromosome 9 at 110,085,501 bp
  • T to C, chromosome 10 at 89,791,419 bp
  • A to T, chromosome 10 at 91,162,112 bp
  • T to C, chromosome 10 at 97,725,552 bp
  • G to T, chromosome 11 at 50,603,488 bp
  • T to A, chromosome 11 at 67,252,564 bp
  • T to A, chromosome 11 at 68,020,988 bp
  • C to T, chromosome 11 at 118,114,195 bp
  • T to C, chromosome 12 at 57,660,496 bp
  • T to C, chromosome 12 at 114,724,190 bp
  • C to A, chromosome 13 at 41,004,738 bp
  • T to C, chromosome 13 at 55,594,804 bp
  • T to C, chromosome 14 at 37,091,978 bp
  • C to T, chromosome 14 at 55,775,240 bp
  • A to G, chromosome 14 at 55,863,791 bp
  • C to T, chromosome 14 at 57,542,480 bp
  • A to T, chromosome 14 at 78,512,489 bp
  • A to C, chromosome 14 at 103,160,675 bp
  • T to G, chromosome 15 at 6,778,319 bp
  • T to C, chromosome 15 at 79,738,924 bp
  • T to C, chromosome 15 at 98,852,597 bp
  • G to A, chromosome 16 at 18,426,541 bp
  • T to C, chromosome 16 at 44,746,313 bp
  • A to G, chromosome 17 at 26,431,991 bp
  • T to A, chromosome 17 at 37,383,231 bp
  • T to C, chromosome 18 at 42,111,428 bp
  • T to C, chromosome 18 at 64,504,387 bp
  • T to C, chromosome 19 at 6,109,673 bp
  • T to C, chromosome 19 at 6,346,566 bp
  • T to A, chromosome 19 at 10,551,972 bp
  • G to A, chromosome 19 at 48,704,369 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8343 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067866-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.