Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8356Btlr/Mmmh
Stock Number:
067870-MU
Citation ID:
RRID:MMRRC_067870-MU
Other Names:
R8356 (G1)
Major Collection:

Strain Information

Mafb
Name: MAF bZIP transcription factor B
Synonyms: Kreisler, Krml1, Krml
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16658
HGNC: HGNC:6408
Homologene: 31315
Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Tal1
Name: T cell acute lymphocytic leukemia 1
Synonyms: SCL/tal-1, Scl, bHLHa17, Hpt
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21349
Homologene: 2400
Sox10
Name: SRY (sex determining region Y)-box 10
Synonyms: Sox21, gt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20665
VEGA: 15
Homologene: 5055
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 38,059,243 bp
  • T to A, chromosome 1 at 40,524,924 bp
  • A to G, chromosome 1 at 66,641,629 bp
  • A to G, chromosome 1 at 68,071,630 bp
  • A to G, chromosome 1 at 136,172,945 bp
  • T to A, chromosome 1 at 151,696,150 bp
  • A to T, chromosome 1 at 171,284,717 bp
  • T to C, chromosome 1 at 180,726,316 bp
  • A to T, chromosome 2 at 24,852,769 bp
  • A to G, chromosome 2 at 32,039,360 bp
  • T to A, chromosome 2 at 65,460,673 bp
  • A to T, chromosome 2 at 70,527,529 bp
  • A to G, chromosome 2 at 112,042,598 bp
  • A to G, chromosome 2 at 113,365,040 bp
  • A to G, chromosome 2 at 126,158,531 bp
  • T to A, chromosome 2 at 155,406,252 bp
  • G to A, chromosome 2 at 160,366,205 bp
  • G to T, chromosome 2 at 163,204,630 bp
  • A to G, chromosome 2 at 176,809,514 bp
  • A to T, chromosome 2 at 177,948,519 bp
  • T to C, chromosome 3 at 58,676,082 bp
  • C to T, chromosome 3 at 108,413,531 bp
  • C to T, chromosome 4 at 9,537,722 bp
  • T to C, chromosome 4 at 43,665,519 bp
  • T to A, chromosome 4 at 44,312,191 bp
  • G to T, chromosome 4 at 115,063,428 bp
  • T to A, chromosome 4 at 133,860,057 bp
  • T to C, chromosome 4 at 139,638,522 bp
  • A to G, chromosome 4 at 141,250,615 bp
  • C to A, chromosome 5 at 3,866,509 bp
  • A to T, chromosome 5 at 62,849,738 bp
  • C to T, chromosome 5 at 91,090,134 bp
  • A to G, chromosome 5 at 94,383,844 bp
  • G to A, chromosome 5 at 111,233,341 bp
  • T to A, chromosome 5 at 113,723,807 bp
  • T to G, chromosome 5 at 129,860,162 bp
  • A to G, chromosome 5 at 135,381,178 bp
  • A to T, chromosome 5 at 137,032,411 bp
  • T to C, chromosome 5 at 146,845,235 bp
  • G to T, chromosome 5 at 149,579,107 bp
  • T to A, chromosome 5 at 149,726,789 bp
  • T to A, chromosome 6 at 47,049,373 bp
  • A to T, chromosome 6 at 57,598,563 bp
  • A to G, chromosome 6 at 72,429,591 bp
  • ATTT to ATTTT, chromosome 6 at 84,844,095 bp
  • G to A, chromosome 6 at 91,074,348 bp
  • A to T, chromosome 6 at 115,948,784 bp
  • A to G, chromosome 6 at 126,924,916 bp
  • A to T, chromosome 6 at 142,590,370 bp
  • C to T, chromosome 7 at 17,745,699 bp
  • T to A, chromosome 7 at 22,163,323 bp
  • T to C, chromosome 7 at 25,722,822 bp
  • T to C, chromosome 7 at 30,589,956 bp
  • T to A, chromosome 7 at 48,802,999 bp
  • A to T, chromosome 7 at 99,472,922 bp
  • A to T, chromosome 7 at 104,260,971 bp
  • A to G, chromosome 7 at 104,960,727 bp
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp
  • T to A, chromosome 7 at 137,199,187 bp
  • C to T, chromosome 8 at 3,600,679 bp
  • A to G, chromosome 8 at 3,667,542 bp
  • T to C, chromosome 8 at 25,581,713 bp
  • G to A, chromosome 8 at 85,261,305 bp
  • G to A, chromosome 8 at 87,783,282 bp
  • A to G, chromosome 8 at 110,533,124 bp
  • G to A, chromosome 8 at 123,228,357 bp
  • A to G, chromosome 9 at 6,266,249 bp
  • A to G, chromosome 9 at 18,658,778 bp
  • A to T, chromosome 9 at 20,348,935 bp
  • A to C, chromosome 9 at 35,053,142 bp
  • T to A, chromosome 9 at 38,143,685 bp
  • G to A, chromosome 9 at 58,878,119 bp
  • T to C, chromosome 9 at 66,514,450 bp
  • A to T, chromosome 9 at 107,917,264 bp
  • T to C, chromosome 10 at 50,649,907 bp
  • C to T, chromosome 10 at 59,355,363 bp
  • T to C, chromosome 10 at 62,621,508 bp
  • A to G, chromosome 10 at 80,006,526 bp
  • A to T, chromosome 10 at 80,732,903 bp
  • A to G, chromosome 10 at 89,812,092 bp
  • C to T, chromosome 11 at 49,293,558 bp
  • A to G, chromosome 11 at 66,156,938 bp
  • T to A, chromosome 11 at 88,834,731 bp
  • C to T, chromosome 11 at 116,349,420 bp
  • T to C, chromosome 12 at 30,011,890 bp
  • A to G, chromosome 12 at 31,466,506 bp
  • T to C, chromosome 12 at 81,734,118 bp
  • A to G, chromosome 12 at 85,290,697 bp
  • T to A, chromosome 12 at 88,177,216 bp
  • A to G, chromosome 12 at 108,691,964 bp
  • T to G, chromosome 12 at 113,546,137 bp
  • A to T, chromosome 13 at 23,762,100 bp
  • A to C, chromosome 13 at 119,339,832 bp
  • C to T, chromosome 14 at 31,273,015 bp
  • A to T, chromosome 14 at 36,890,374 bp
  • A to G, chromosome 14 at 54,172,338 bp
  • A to T, chromosome 14 at 57,697,410 bp
  • A to T, chromosome 14 at 79,359,475 bp
  • A to G, chromosome 15 at 28,444,167 bp
  • C to T, chromosome 15 at 28,444,323 bp
  • T to G, chromosome 15 at 79,156,452 bp
  • A to G, chromosome 15 at 103,242,102 bp
  • A to T, chromosome 16 at 11,894,929 bp
  • C to T, chromosome 16 at 18,245,306 bp
  • CAC to CACTAC, chromosome 16 at 32,754,076 bp
  • G to A, chromosome 16 at 75,600,806 bp
  • T to A, chromosome 17 at 24,904,951 bp
  • T to G, chromosome 17 at 67,737,496 bp
  • T to A, chromosome 18 at 37,422,199 bp
  • T to C, chromosome 18 at 39,111,848 bp
  • T to C, chromosome 19 at 4,612,228 bp
  • T to G, chromosome 19 at 6,926,300 bp
  • T to A, chromosome 19 at 34,573,508 bp
  • G to A, chromosome 19 at 41,774,176 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8356 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067870-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.