Strain Name:
C57BL/6J-MtgxR8356Btlr/Mmmh
Stock Number:
067870-MU
Citation ID:
RRID:MMRRC_067870-MU
Other Names:
R8356 (G1)
Major Collection:

Strain Information

Mafb
Name: MAF bZIP transcription factor B
Synonyms: Kreisler, Krml, Krml1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16658
HGNC: HGNC:6408
Homologene: 31315
Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: Nav1.3, LOC381367
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Tal1
Name: T cell acute lymphocytic leukemia 1
Synonyms: Scl, bHLHa17, Hpt, SCL/tal-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21349
Homologene: 2400
Sox10
Name: SRY (sex determining region Y)-box 10
Synonyms: gt, Sox21
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20665
VEGA: 15
Homologene: 5055
Zfp423
Name: zinc finger protein 423
Synonyms: Zfp104, Ebfaz, Roaz, ataxia1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Exoc6b
Name: exocyst complex component 6B
Synonyms: G430127E12Rik, Sec15l2, 4930569O18Rik, Sec15b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75914
Homologene: 44781
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: KMT1D, 9230102N17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Ranbp1
Name: RAN binding protein 1
Synonyms: Htf9a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19385
HGNC: HGNC:9847
Homologene: 21600
Hnrnpa1
Name: heterogeneous nuclear ribonucleoprotein A1
Synonyms: Hdp, D15Ertd119e, Hnrpa1, hnrnp-A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15382
VEGA: 15
Homologene: 134628
Camsap3
Name: calmodulin regulated spectrin-associated protein family, member 3
Synonyms: Nezha, 2310057J16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69697
Homologene: 18966
Ddx50
Name: DExD box helicase 50
Synonyms: GU2, 4933429B04Rik, 8430408E17Rik, RH-II/Gubeta, DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 94213
VEGA: 10
Homologene: 56986
Zbtb32
Name: zinc finger and BTB domain containing 32
Synonyms: Tzfp, Rog, PLZP, 4930524C15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 58206
Homologene: 8661
Rps6ka1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: Rsk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20111
Homologene: 55703
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: B630009I04Rik, ASC1p200, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Rev1
Name: REV1, DNA directed polymerase
Synonyms: 1110027I23Rik, Rev1l, REV1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Hnrnpul1
Name: heterogeneous nuclear ribonucleoprotein U-like 1
Synonyms: E1BAP5, Hnrnpul, Hnrpul1, E130317O14Rik, E1B-AP5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232989
Homologene: 31419
Vps35
Name: VPS35 retromer complex component
Synonyms: Mem3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65114
Homologene: 6221
Acbd3
Name: acyl-Coenzyme A binding domain containing 3
Synonyms: 8430407O11Rik, Pap7, D1Ertd10e, Gocap1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170760
Homologene: 11227
Bltp3b
Name: bridge-like lipid transfer protein family member 3B
Synonyms: 4930506D01Rik, E030041M21Rik, Uhrf1bp1l, 2010319N22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75089
VEGA: 10
Homologene: 12590
Nup214
Name: nucleoporin 214
Synonyms: D2H9S46E, CAN
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227720
HGNC: HGNC:8064
Homologene: 38008
Akap1
Name: A kinase anchor protein 1
Synonyms: AKAP121, AKAP84, S-AKAP84, DAKAP1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11640
HGNC: HGNC:367
Homologene: 31165
Ereg
Name: epiregulin
Synonyms: EPR
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13874
HGNC: HGNC:3443
Homologene: 1097
Aldh4a1
Name: aldehyde dehydrogenase 4 family, member A1
Synonyms: A930035F14Rik, Ahd-1, ALDH4, Ssdh1, Ahd1, P5CDH
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212647
HGNC: HGNC:406
Homologene: 6081
Naa16
Name: N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms: 1300019C06Rik, Narg1l
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66897
Homologene: 134838
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: Bolvr, mBLVR1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Ccser2
Name: coiled-coil serine rich 2
Synonyms: 2900054P12Rik, Gcap14, 1700012P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72972
Homologene: 10367
Melk
Name: maternal embryonic leucine zipper kinase
Synonyms: MPK38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17279
Homologene: 32111
Zdhhc13
Name: zinc finger, DHHC domain containing 13
Synonyms: 2410004E01Rik, kojak, skc4, Hip14l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243983
Homologene: 75106
Neo1
Name: neogenin
Synonyms: D930014N22Rik, 2610028H22Rik, Igdcc2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18007
VEGA: 9
HGNC: HGNC:7754
Homologene: 1870
Lrfn4
Name: leucine rich repeat and fibronectin type III domain containing 4
Synonyms: SALM3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225875
Homologene: 36415
Ebf3
Name: early B cell factor 3
Synonyms: Olf-1/EBF-like 2, 3110018A08Rik, O/E-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13593
Homologene: 56472
Muc16
Name: mucin 16
Synonyms: 1110008I14Rik, Gm21044, LOC385009
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Mapk8ip3
Name: mitogen-activated protein kinase 8 interacting protein 3
Synonyms: JSAP1, Jip3, JNK-interacting protein 3, JUN/SAPK-associated protein 1, Syd2, sunday driver 2, D17Wsu15e, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, JSAP1a, JSAP1b, JSAP1c, JSAP1d
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 30957
HGNC: HGNC:6884
Homologene: 22790
Asph
Name: aspartate-beta-hydroxylase
Synonyms: jumbug, calsequestrin-binding protein, Junctin, 2310005F16Rik, cI-37, aspartyl beta-hydroxylase, BAH, junctate, 3110001L23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Dtwd1
Name: DTW domain containing 1
Synonyms: 1810033A06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69185
Homologene: 10633
Arhgap19
Name: Rho GTPase activating protein 19
Synonyms: 4933411B03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71085
Homologene: 13159
Pom121
Name: nuclear pore membrane protein 121
Synonyms: 2610027A18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 107939
Homologene: 70878
Cpped1
Name: calcineurin-like phosphoesterase domain containing 1
Synonyms: C530044N13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 223978
Homologene: 10142
Cdk10
Name: cyclin dependent kinase 10
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234854
HGNC: HGNC:1770
Homologene: 55769
H3c1
Name: H3 clustered histone 1
Synonyms: Hist1h3a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 360198
Homologene: 134487
Mst1r
Name: macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Synonyms: STK, Fv-2, friend virus susceptibility 2, Fv2, Ron, PTK8, CDw136
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19882
HGNC: HGNC:7381
Homologene: 1835
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, B230373P09Rik, E030034C22Rik, G1-415-19, Dnahc1, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Rnf157
Name: ring finger protein 157
Synonyms: A130073L17Rik, 2610036E23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217340
Homologene: 28235
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy3, hyrh, hy-3, 1700034M11Rik, 4930545D19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b1565Clo, b2b3491Clo, Mdnah5, b2b1154Clo, b2b1537Clo, Dnahc5, b2b1134Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Wdr95
Name: WD40 repeat domain 95
Synonyms: 4930434E21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381693
Homologene: 124480
Pcdhb11
Name: protocadherin beta 11
Synonyms: PcdhbK, Pcdhb5E
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93882
HGNC: HGNC:8690
Homologene: 62178
Zfp560
Name: zinc finger protein 560
Synonyms: 2310030G09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 434377
Homologene: 103820
Ncoa6
Name: nuclear receptor coactivator 6
Synonyms: NRC, ASC2, PRIP, ASC-2, AIB3, RAP250
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56406
Homologene: 137337
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: flamingo, mfmi1, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Ifit2
Name: interferon-induced protein with tetratricopeptide repeats 2
Synonyms: Ifi54
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15958
HGNC: HGNC:5409
Homologene: 1187
Siah2
Name: siah E3 ubiquitin protein ligase 2
Synonyms: Sinh2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20439
Homologene: 21053
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: Dnahc9, D11Ertd686e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Degs2
Name: delta 4-desaturase, sphingolipid 2
Synonyms: Des2, 2210008A03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70059
VEGA: 12
Homologene: 23617
Lrrd1
Name: leucine rich repeats and death domain containing 1
Synonyms: 4932412H11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242838
Homologene: 18247
H1f8
Name: H1.8 linker histone
Synonyms: H1foo, H1-8, H1oo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171506
Homologene: 51377
Abcc9
Name: ATP-binding cassette, sub-family C member 9
Synonyms: Sur2, SUR2A, SUR2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Or52e18
Name: olfactory receptor family 52 subfamily E member 18
Synonyms: Olfr670, MOR32-8, GA_x6K02T2PBJ9-7589577-7588639
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384703
Homologene: 105163
Rbm11
Name: RNA binding motif protein 11
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224344
HGNC: HGNC:9897
Homologene: 16988
Letm2
Name: leucine zipper-EF-hand containing transmembrane protein 2
Synonyms: D030041N04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270035
Homologene: 56358
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69675
Homologene: 33907
Adam6a
Name: a disintegrin and metallopeptidase domain 6A
Synonyms: Adam6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238406
HGNC: HGNC:213
Homologene: 128362
Dthd1
Name: death domain containing 1
Synonyms: Gm17384
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100322896
Homologene: 123510
Nup210
Name: nucleoporin 210
Synonyms: gp190, Pom210, gp210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Sumf2
Name: sulfatase modifying factor 2
Synonyms: 2610040F05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67902
Homologene: 41037
Mcemp1
Name: mast cell expressed membrane protein 1
Synonyms: 1810033B17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69189
Homologene: 52162
Trim34a
Name: tripartite motif-containing 34A
Synonyms: Trim34, Trim34-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94094
Homologene: 128238
Nnt
Name: nicotinamide nucleotide transhydrogenase
Synonyms: 4930423F13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18115
HGNC: HGNC:7863
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: SH2-B, SH2-Bb, Irip, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Vgf
Name: VGF nerve growth factor inducible
Synonyms: LOC381677
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381677
Homologene: 2536
P4ha1
Name: procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide
Synonyms: P4ha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18451
HGNC: HGNC:8546
Homologene: 30998
Kcnk4
Name: potassium channel, subfamily K, member 4
Synonyms: TRAAKt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16528
VEGA: 19
HGNC: HGNC:6279
Homologene: 7391
B3glct
Name: beta-3-glucosyltransferase
Synonyms: B3galtl, LOC381694
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381694
Homologene: 14978
Kif21b
Name: kinesin family member 21B
Synonyms: 2610511N21Rik, N-5 kinesin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16565
Homologene: 56868
Herc6
Name: hect domain and RLD 6
Synonyms: 1700121D12Rik, 4930427L17Rik, CEB1, Herc5, 2510038N07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67138
Homologene: 70768
Niban1
Name: niban apoptosis regulator 1
Synonyms: Niban, Fam129a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63913
Homologene: 62170
Arhgap26
Name: Rho GTPase activating protein 26
Synonyms: 2610010G17Rik, 4933432P15Rik, 1810044B20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71302
Homologene: 36349
Rad51ap1
Name: RAD51 associated protein 1
Synonyms: 2510006L10Rik, RAB22
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19362
Homologene: 48436
Klhl35
Name: kelch-like 35
Synonyms: 2810406K13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72184
Homologene: 27849
Arhgef19
Name: Rho guanine nucleotide exchange factor 19
Synonyms: WGEF, 6430573B13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 213649
Homologene: 17710
Fmn1
Name: formin 1
Synonyms: formin-1, Fmn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14260
HGNC: HGNC:3768
Homologene: 121778
Or2y1f
Name: olfactory receptor family 2 subfamily Y member 1F
Synonyms: GA_x6K02T2QP88-6141322-6140387, MOR256-25, Olfr1392
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258462
Homologene: 81347
St3gal4
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 4
Synonyms: ST3Gal IV, Siat4c
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20443
VEGA: 9
Homologene: 4572
Slc26a3
Name: solute carrier family 26, member 3
Synonyms: Dra, 9030623B18Rik, 9130013M11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13487
HGNC: HGNC:3018
Homologene: 55435
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: Psg30, 1600029H12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
HGNC: HGNC:1819
Homologene: 115938
Ddi1
Name: DNA-damage inducible 1
Synonyms: 1700011N24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71829
VEGA: 9
Homologene: 100549
Erich2
Name: glutamate rich 2
Synonyms: 4933404M02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66748
Homologene: 75226
Ggcx
Name: gamma-glutamyl carboxylase
Synonyms: vitamin K-dependent carboxylase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56316
HGNC: HGNC:4247
Homologene: 639
Abca7
Name: ATP-binding cassette, sub-family A member 7
Synonyms: Abc51
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27403
HGNC: HGNC:37
Homologene: 22783
Usp21
Name: ubiquitin specific peptidase 21
Synonyms: W53272, Usp23, Usp16, ESTM28
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30941
Homologene: 56572
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Or8b41
Name: olfactory receptor family 8 subfamily B member 41
Synonyms: MOR162-15_p, MOR162-3, Olfr890, GA_x6K02T2PVTD-31822365-31823309
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258474
Homologene: 138311
Lats2
Name: large tumor suppressor 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50523
HGNC: HGNC:6515
Homologene: 56678
Tox2
Name: TOX high mobility group box family member 2
Synonyms: LOC269389, RxHMG1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269389
Homologene: 13155
Zc2hc1c
Name: zinc finger, C2HC-type containing 1C
Synonyms: Fam164c, 2810002I04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72350
Homologene: 23461
Fam221b
Name: family with sequence similarity 221, member B
Synonyms: 4930412F15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242408
Homologene: 52184
Or4f59
Name: olfactory receptor family 4 subfamily F member 59
Synonyms: MOR245-20, GA_x6K02T2Q125-73090482-73089529, Olfr1312
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258359
Homologene: 128122
Gm14295
Name: predicted gene 14295
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100039123
Homologene: 133105
Rasl11a
Name: RAS-like, family 11, member A
Synonyms: 1110065D03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68895
Homologene: 45783
Fbxl22
Name: F-box and leucine-rich repeat protein 22
Synonyms: 1110004B15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74165
VEGA: 9
Homologene: 35275
Pramel52-ps
Name: PRAME like 52, pseudogene
Synonyms: AA792892
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100554
Homologene: 133359
Gm14326
Name: predicted gene 14326
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665211
Homologene: 134324
Pramel51
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
1700069L16Rik
Name: RIKEN cDNA 1700069L16 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381707
Vmn1r142
Name: vomeronasal 1 receptor 142
Synonyms: Gm8647
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667464
Homologene: 104166
Traj46
Name: T cell receptor alpha joining 46
Synonyms: Gm16928
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100124342
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 38,059,243 bp
  • T to A, chromosome 1 at 40,524,924 bp
  • A to G, chromosome 1 at 66,641,629 bp
  • A to G, chromosome 1 at 68,071,630 bp
  • A to G, chromosome 1 at 136,172,945 bp
  • T to A, chromosome 1 at 151,696,150 bp
  • A to T, chromosome 1 at 171,284,717 bp
  • T to C, chromosome 1 at 180,726,316 bp
  • A to T, chromosome 2 at 24,852,769 bp
  • A to G, chromosome 2 at 32,039,360 bp
  • T to A, chromosome 2 at 65,460,673 bp
  • A to T, chromosome 2 at 70,527,529 bp
  • A to G, chromosome 2 at 112,042,598 bp
  • A to G, chromosome 2 at 113,365,040 bp
  • A to G, chromosome 2 at 126,158,531 bp
  • T to A, chromosome 2 at 155,406,252 bp
  • G to A, chromosome 2 at 160,366,205 bp
  • G to T, chromosome 2 at 163,204,630 bp
  • A to G, chromosome 2 at 176,809,514 bp
  • A to T, chromosome 2 at 177,948,519 bp
  • T to C, chromosome 3 at 58,676,082 bp
  • C to T, chromosome 3 at 108,413,531 bp
  • C to T, chromosome 4 at 9,537,722 bp
  • T to C, chromosome 4 at 43,665,519 bp
  • T to A, chromosome 4 at 44,312,191 bp
  • G to T, chromosome 4 at 115,063,428 bp
  • T to A, chromosome 4 at 133,860,057 bp
  • T to C, chromosome 4 at 139,638,522 bp
  • A to G, chromosome 4 at 141,250,615 bp
  • C to A, chromosome 5 at 3,866,509 bp
  • A to T, chromosome 5 at 62,849,738 bp
  • C to T, chromosome 5 at 91,090,134 bp
  • A to G, chromosome 5 at 94,383,844 bp
  • G to A, chromosome 5 at 111,233,341 bp
  • T to A, chromosome 5 at 113,723,807 bp
  • T to G, chromosome 5 at 129,860,162 bp
  • A to G, chromosome 5 at 135,381,178 bp
  • A to T, chromosome 5 at 137,032,411 bp
  • T to C, chromosome 5 at 146,845,235 bp
  • G to T, chromosome 5 at 149,579,107 bp
  • T to A, chromosome 5 at 149,726,789 bp
  • T to A, chromosome 6 at 47,049,373 bp
  • A to T, chromosome 6 at 57,598,563 bp
  • A to G, chromosome 6 at 72,429,591 bp
  • ATTT to ATTTT, chromosome 6 at 84,844,095 bp
  • G to A, chromosome 6 at 91,074,348 bp
  • A to T, chromosome 6 at 115,948,784 bp
  • A to G, chromosome 6 at 126,924,916 bp
  • A to T, chromosome 6 at 142,590,370 bp
  • C to T, chromosome 7 at 17,745,699 bp
  • T to A, chromosome 7 at 22,163,323 bp
  • T to C, chromosome 7 at 25,722,822 bp
  • T to C, chromosome 7 at 30,589,956 bp
  • T to A, chromosome 7 at 48,802,999 bp
  • A to T, chromosome 7 at 99,472,922 bp
  • A to T, chromosome 7 at 104,260,971 bp
  • A to G, chromosome 7 at 104,960,727 bp
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp
  • T to A, chromosome 7 at 137,199,187 bp
  • C to T, chromosome 8 at 3,600,679 bp
  • A to G, chromosome 8 at 3,667,542 bp
  • T to C, chromosome 8 at 25,581,713 bp
  • G to A, chromosome 8 at 85,261,305 bp
  • G to A, chromosome 8 at 87,783,282 bp
  • A to G, chromosome 8 at 110,533,124 bp
  • G to A, chromosome 8 at 123,228,357 bp
  • A to G, chromosome 9 at 6,266,249 bp
  • A to G, chromosome 9 at 18,658,778 bp
  • A to T, chromosome 9 at 20,348,935 bp
  • A to C, chromosome 9 at 35,053,142 bp
  • T to A, chromosome 9 at 38,143,685 bp
  • G to A, chromosome 9 at 58,878,119 bp
  • T to C, chromosome 9 at 66,514,450 bp
  • A to T, chromosome 9 at 107,917,264 bp
  • T to C, chromosome 10 at 50,649,907 bp
  • C to T, chromosome 10 at 59,355,363 bp
  • T to C, chromosome 10 at 62,621,508 bp
  • A to G, chromosome 10 at 80,006,526 bp
  • A to T, chromosome 10 at 80,732,903 bp
  • A to G, chromosome 10 at 89,812,092 bp
  • C to T, chromosome 11 at 49,293,558 bp
  • A to G, chromosome 11 at 66,156,938 bp
  • T to A, chromosome 11 at 88,834,731 bp
  • C to T, chromosome 11 at 116,349,420 bp
  • T to C, chromosome 12 at 30,011,890 bp
  • A to G, chromosome 12 at 31,466,506 bp
  • T to C, chromosome 12 at 81,734,118 bp
  • A to G, chromosome 12 at 85,290,697 bp
  • T to A, chromosome 12 at 88,177,216 bp
  • A to G, chromosome 12 at 108,691,964 bp
  • T to G, chromosome 12 at 113,546,137 bp
  • A to T, chromosome 13 at 23,762,100 bp
  • A to C, chromosome 13 at 119,339,832 bp
  • C to T, chromosome 14 at 31,273,015 bp
  • A to T, chromosome 14 at 36,890,374 bp
  • A to G, chromosome 14 at 54,172,338 bp
  • A to T, chromosome 14 at 57,697,410 bp
  • A to T, chromosome 14 at 79,359,475 bp
  • A to G, chromosome 15 at 28,444,167 bp
  • C to T, chromosome 15 at 28,444,323 bp
  • T to G, chromosome 15 at 79,156,452 bp
  • A to G, chromosome 15 at 103,242,102 bp
  • A to T, chromosome 16 at 11,894,929 bp
  • C to T, chromosome 16 at 18,245,306 bp
  • CAC to CACTAC, chromosome 16 at 32,754,076 bp
  • G to A, chromosome 16 at 75,600,806 bp
  • T to A, chromosome 17 at 24,904,951 bp
  • T to G, chromosome 17 at 67,737,496 bp
  • T to A, chromosome 18 at 37,422,199 bp
  • T to C, chromosome 18 at 39,111,848 bp
  • T to C, chromosome 19 at 4,612,228 bp
  • T to G, chromosome 19 at 6,926,300 bp
  • T to A, chromosome 19 at 34,573,508 bp
  • G to A, chromosome 19 at 41,774,176 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8356 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067870-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.