Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8432Btlr/Mmmh
Stock Number:
067882-MU
Citation ID:
RRID:MMRRC_067882-MU
Other Names:
R8432 (G1)
Major Collection:

Strain Information

Agpat5
Name: 1-acylglycerol-3-phosphate O-acyltransferase 5
Synonyms: 1110013A05Rik, D8Ertd319e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52123
Homologene: 10153
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Cd2ap
Name: CD2-associated protein
Synonyms: METS-1, Mets1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12488
VEGA: 17
Homologene: 7663
Cpne3
Name: copine III
Synonyms: PRO1071, CPN3, 5730450C07Rik, 5430428M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Taf15
Name: TATA-box binding protein associated factor 15
Synonyms: TAFII68, 2610111C21Rik, Taf2n, 68kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70439
Homologene: 131088
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 44,167,681 bp
  • G to C, chromosome 1 at 53,618,036 bp
  • C to T, chromosome 1 at 74,928,044 bp
  • T to A, chromosome 2 at 13,381,799 bp
  • A to T, chromosome 2 at 67,510,618 bp
  • C to T, chromosome 2 at 76,863,556 bp
  • G to T, chromosome 2 at 120,038,596 bp
  • A to G, chromosome 2 at 148,690,195 bp
  • A to G, chromosome 2 at 178,069,553 bp
  • A to G, chromosome 2 at 180,714,861 bp
  • G to A, chromosome 3 at 88,070,059 bp
  • G to A, chromosome 3 at 103,820,819 bp
  • T to C, chromosome 3 at 138,941,787 bp
  • A to T, chromosome 4 at 19,535,227 bp
  • G to T, chromosome 4 at 116,163,954 bp
  • A to G, chromosome 4 at 132,291,917 bp
  • A to T, chromosome 5 at 31,309,103 bp
  • A to G, chromosome 5 at 112,764,512 bp
  • T to G, chromosome 5 at 120,175,926 bp
  • A to G, chromosome 6 at 13,602,536 bp
  • A to G, chromosome 6 at 81,962,155 bp
  • TG to TGG, chromosome 6 at 108,664,857 bp
  • A to G, chromosome 7 at 25,615,108 bp
  • A to G, chromosome 7 at 56,155,112 bp
  • A to C, chromosome 7 at 77,124,686 bp
  • A to G, chromosome 7 at 100,260,053 bp
  • T to G, chromosome 7 at 104,975,992 bp
  • A to T, chromosome 7 at 114,273,845 bp
  • C to T, chromosome 7 at 119,442,787 bp
  • A to T, chromosome 8 at 18,846,761 bp
  • A to C, chromosome 8 at 33,576,544 bp
  • A to T, chromosome 8 at 104,113,066 bp
  • T to A, chromosome 8 at 106,257,677 bp
  • A to T, chromosome 8 at 110,597,951 bp
  • TGCCGCCGCCGCCGC to TGCCGCCGCCGC, chromosome 8 at 124,794,062 bp
  • A to G, chromosome 9 at 38,115,976 bp
  • G to A, chromosome 9 at 59,780,265 bp
  • A to T, chromosome 9 at 77,190,729 bp
  • A to C, chromosome 9 at 96,686,238 bp
  • A to G, chromosome 9 at 122,368,252 bp
  • A to T, chromosome 10 at 23,950,155 bp
  • A to T, chromosome 10 at 52,391,784 bp
  • G to A, chromosome 10 at 76,420,205 bp
  • AGAAGTGGAGGCTACGGTGGAGACCGAAGTGG to AGAAGTGG, chromosome 11 at 83,505,025 bp
  • G to A, chromosome 12 at 72,664,807 bp
  • A to T, chromosome 12 at 101,649,104 bp
  • A to T, chromosome 12 at 110,618,142 bp
  • T to C, chromosome 13 at 38,037,492 bp
  • T to G, chromosome 13 at 55,247,703 bp
  • T to C, chromosome 13 at 97,951,583 bp
  • T to C, chromosome 14 at 14,013,635 bp
  • T to A, chromosome 14 at 20,320,930 bp
  • T to A, chromosome 14 at 51,822,178 bp
  • T to A, chromosome 14 at 51,989,400 bp
  • A to T, chromosome 15 at 27,664,732 bp
  • A to G, chromosome 15 at 78,013,322 bp
  • T to G, chromosome 15 at 85,817,293 bp
  • T to C, chromosome 15 at 98,815,544 bp
  • C to T, chromosome 17 at 28,899,571 bp
  • A to T, chromosome 17 at 42,798,593 bp
  • A to G, chromosome 17 at 62,651,022 bp
  • A to T, chromosome 17 at 78,803,501 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8432 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067882-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.